e.g. 1:1246..9423
SNP Detail For snp_cf0038000895785    [See in GBrowse]
1.General Information
SNP ID: snp_cf0038000895785
Organism: Canis familiaris
Individual: KM3
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: GAGCCGTGTCTGCGAACATCAGGGACCTGA
3'flank: GCTGCAGAGTGTGAGCAGACGCCCCGTGAT
3.Reference Map information
Chrom Position Reference KM3
Chr17 727692 C T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003214 43289 + C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000005158 632 ACG => ATG ENSCAFP00000004775 211 T => M
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0035001135836 KM10 Y GAGCCGTGTCTGCGAACATCAGGGACCTGA GCTGCAGAGTGTGAGCAGACGCCCCGTGAT 2014-07-19 2014-07-19
snp_cf0033000913248 GS9 T GAGCCGTGTCTGCGAACATCAGGGACCTGA GCTGCAGAGTGTGAGCAGACGCCCCGTGAT 2014-07-19 2014-07-19
snp_cf0051001176696 LJ6 Y GAGCCGTGTCTGCGAACATCAGGGACCTGA GCTGCAGAGTGTGAGCAGACGCCCCGTGAT 2014-07-19 2014-07-19
snp_cf0032000906938 GS8 Y GAGCCGTGTCTGCGAACATCAGGGACCTGA GCTGCAGAGTGTGAGCAGACGCCCCGTGAT 2014-07-19 2014-07-19
snp_cf0042001218737 KM7 Y GAGCCGTGTCTGCGAACATCAGGGACCTGA GCTGCAGAGTGTGAGCAGACGCCCCGTGAT 2014-07-19 2014-07-19
snp_cf0047001130125 LJ2 Y GAGCCGTGTCTGCGAACATCAGGGACCTGA GCTGCAGAGTGTGAGCAGACGCCCCGTGAT 2014-07-19 2014-07-19
snp_cf0029000851420 GS5 T GAGCCGTGTCTGCGAACATCAGGGACCTGA GCTGCAGAGTGTGAGCAGACGCCCCGTGAT 2014-07-19 2014-07-19
snp_cf0039000943671 KM4 Y GAGCCGTGTCTGCGAACATCAGGGACCTGA GCTGCAGAGTGTGAGCAGACGCCCCGTGAT 2014-07-19 2014-07-19
snp_cf0056001488669 LUPWRUS00001 Y GAGCCGTGTCTGCGAACATCAGGGACCTGA GCTGCAGAGTGTGAGCAGACGCCCCGTGAT 2014-07-19 2014-07-19
snp_cf0044001042114 KM9 Y GAGCCGTGTCTGCGAACATCAGGGACCTGA GCTGCAGAGTGTGAGCAGACGCCCCGTGAT 2014-07-19 2014-07-19
snp_cf0010001158246 DQ2 Y GAGCCGTGTCTGCGAACATCAGGGACCTGA GCTGCAGAGTGTGAGCAGACGCCCCGTGAT 2014-07-19 2014-07-19
snp_cf0058001474230 LUPWRUS00003 Y GAGCCGTGTCTGCGAACATCAGGGACCTGA GCTGCAGAGTGTGAGCAGACGCCCCGTGAT 2014-07-19 2014-07-19
snp_cf0019000908184 FAMBGSD00001 T GAGCCGTGTCTGCGAACATCAGGGACCTGA GCTGCAGAGTGTGAGCAGACGCCCCGTGAT 2014-07-19 2014-07-19
snp_cf0030000933448 GS6 T GAGCCGTGTCTGCGAACATCAGGGACCTGA GCTGCAGAGTGTGAGCAGACGCCCCGTGAT 2014-07-19 2014-07-19
snp_cf0026000907838 GS2 T GAGCCGTGTCTGCGAACATCAGGGACCTGA GCTGCAGAGTGTGAGCAGACGCCCCGTGAT 2014-07-19 2014-07-19
snp_cf0024000951814 GS10 T GAGCCGTGTCTGCGAACATCAGGGACCTGA GCTGCAGAGTGTGAGCAGACGCCCCGTGAT 2014-07-19 2014-07-19
snp_cf0025000911065 GS1 T GAGCCGTGTCTGCGAACATCAGGGACCTGA GCTGCAGAGTGTGAGCAGACGCCCCGTGAT 2014-07-19 2014-07-19
snp_cf0068001122400 TM9 Y GAGCCGTGTCTGCGAACATCAGGGACCTGA GCTGCAGAGTGTGAGCAGACGCCCCGTGAT 2014-07-19 2014-07-19
snp_cf0040001033502 KM5 Y GAGCCGTGTCTGCGAACATCAGGGACCTGA GCTGCAGAGTGTGAGCAGACGCCCCGTGAT 2014-07-19 2014-07-19
snp_cf0041001176473 KM6 Y GAGCCGTGTCTGCGAACATCAGGGACCTGA GCTGCAGAGTGTGAGCAGACGCCCCGTGAT 2014-07-19 2014-07-19
snp_cf0027000913258 GS3 T GAGCCGTGTCTGCGAACATCAGGGACCTGA GCTGCAGAGTGTGAGCAGACGCCCCGTGAT 2014-07-19 2014-07-19
snp_cf0028000867669 GS4 Y GAGCCGTGTCTGCGAACATCAGGGACCTGA GCTGCAGAGTGTGAGCAGACGCCCCGTGAT 2014-07-19 2014-07-19
snp_cf0031000919998 GS7 T GAGCCGTGTCTGCGAACATCAGGGACCTGA GCTGCAGAGTGTGAGCAGACGCCCCGTGAT 2014-07-19 2014-07-19
snp_cf0021001116011 FAMICHN00001 Y GAGCCGTGTCTGCGAACATCAGGGACCTGA GCTGCAGAGTGTGAGCAGACGCCCCGTGAT 2014-07-19 2014-07-19
snp_cf0004000977260 Basenji T GAGCCGTGTCTGCGAACATCAGGGACCTGA GCTGCAGAGTGTGAGCAGACGCCCCGTGAT 2014-07-19 2014-07-19
6.Fasta Information
GGAGGGCGCC GCCTGGCTGA GAGCCGTGTC TGCGAACATC AGGGACCTGA
T
GCTGCAGAGT GTGAGCAGAC GCCCCGTGAT TTAGGCCTCC ACGCTTTGTC