e.g. 1:1246..9423
SNP Detail For snp_cf0038000895801    [See in GBrowse]
1.General Information
SNP ID: snp_cf0038000895801
Organism: Canis familiaris
Individual: KM3
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: S
5'flank: CACGCGGACTCCGGCCTGGAGCCTTGGGGC
3'flank: TCGAGGACCCGCAGCCCTACTGCTTCAGCG
3.Reference Map information
Chrom Position Reference KM3
Chr17 743918 C S
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003214 59515 + C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000005158 928 CTC => GTC ENSCAFP00000004775 310 L => V
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0021001116028 FAMICHN00001 S CACGCGGACTCCGGCCTGGAGCCTTGGGGC TCGAGGACCCGCAGCCCTACTGCTTCAGCG 2014-07-19 2014-07-19
snp_cf0033000913264 GS9 G CACGCGGACTCCGGCCTGGAGCCTTGGGGC TCGAGGACCCGCAGCCCTACTGCTTCAGCG 2014-07-19 2014-07-19
snp_cf0039000943687 KM4 S CACGCGGACTCCGGCCTGGAGCCTTGGGGC TCGAGGACCCGCAGCCCTACTGCTTCAGCG 2014-07-19 2014-07-19
snp_cf0035001135850 KM10 S CACGCGGACTCCGGCCTGGAGCCTTGGGGC TCGAGGACCCGCAGCCCTACTGCTTCAGCG 2014-07-19 2014-07-19
snp_cf0037000995097 KM2 S CACGCGGACTCCGGCCTGGAGCCTTGGGGC TCGAGGACCCGCAGCCCTACTGCTTCAGCG 2014-07-19 2014-07-19
snp_cf0029000851436 GS5 G CACGCGGACTCCGGCCTGGAGCCTTGGGGC TCGAGGACCCGCAGCCCTACTGCTTCAGCG 2014-07-19 2014-07-19
snp_cf0027000913275 GS3 G CACGCGGACTCCGGCCTGGAGCCTTGGGGC TCGAGGACCCGCAGCCCTACTGCTTCAGCG 2014-07-19 2014-07-19
snp_cf0068001122415 TM9 S CACGCGGACTCCGGCCTGGAGCCTTGGGGC TCGAGGACCCGCAGCCCTACTGCTTCAGCG 2014-07-19 2014-07-19
snp_cf0042001218771 KM7 S CACGCGGACTCCGGCCTGGAGCCTTGGGGC TCGAGGACCCGCAGCCCTACTGCTTCAGCG 2014-07-19 2014-07-19
snp_cf0026000907854 GS2 G CACGCGGACTCCGGCCTGGAGCCTTGGGGC TCGAGGACCCGCAGCCCTACTGCTTCAGCG 2014-07-19 2014-07-19
snp_cf0041001176505 KM6 S CACGCGGACTCCGGCCTGGAGCCTTGGGGC TCGAGGACCCGCAGCCCTACTGCTTCAGCG 2014-07-19 2014-07-19
snp_cf0019000908200 FAMBGSD00001 G CACGCGGACTCCGGCCTGGAGCCTTGGGGC TCGAGGACCCGCAGCCCTACTGCTTCAGCG 2014-07-19 2014-07-19
snp_cf0020001160561 FAMBTIM00001 S CACGCGGACTCCGGCCTGGAGCCTTGGGGC TCGAGGACCCGCAGCCCTACTGCTTCAGCG 2014-07-19 2014-07-19
snp_cf0031000920015 GS7 G CACGCGGACTCCGGCCTGGAGCCTTGGGGC TCGAGGACCCGCAGCCCTACTGCTTCAGCG 2014-07-19 2014-07-19
snp_cf0024000951830 GS10 G CACGCGGACTCCGGCCTGGAGCCTTGGGGC TCGAGGACCCGCAGCCCTACTGCTTCAGCG 2014-07-19 2014-07-19
snp_cf0025000911081 GS1 G CACGCGGACTCCGGCCTGGAGCCTTGGGGC TCGAGGACCCGCAGCCCTACTGCTTCAGCG 2014-07-19 2014-07-19
snp_cf0004000977273 Basenji S CACGCGGACTCCGGCCTGGAGCCTTGGGGC TCGAGGACCCGCAGCCCTACTGCTTCAGCG 2014-07-19 2014-07-19
snp_cf0032000906954 GS8 S CACGCGGACTCCGGCCTGGAGCCTTGGGGC TCGAGGACCCGCAGCCCTACTGCTTCAGCG 2014-07-19 2014-07-19
snp_cf0044001042131 KM9 S CACGCGGACTCCGGCCTGGAGCCTTGGGGC TCGAGGACCCGCAGCCCTACTGCTTCAGCG 2014-07-19 2014-07-19
snp_cf0030000933465 GS6 G CACGCGGACTCCGGCCTGGAGCCTTGGGGC TCGAGGACCCGCAGCCCTACTGCTTCAGCG 2014-07-19 2014-07-19
snp_cf0040001033518 KM5 S CACGCGGACTCCGGCCTGGAGCCTTGGGGC TCGAGGACCCGCAGCCCTACTGCTTCAGCG 2014-07-19 2014-07-19
6.Fasta Information
TCCCTGACGA CTGCTGGCTG CACGCGGACT CCGGCCTGGA GCCTTGGGGC
S
TCGAGGACCC GCAGCCCTAC TGCTTCAGCG TCCTGGTCGG CCACGGCCAG