e.g. 1:1246..9423
SNP Detail For snp_cf0039000000009    [See in GBrowse]
1.General Information
SNP ID: snp_cf0039000000009
Organism: Canis familiaris
Individual: KM4
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: K
5'flank: AAAGGTCTAGGCTCGCTGCTTGACGGAAGT
3'flank: TCGGGAGAGGTAATTGGAATCTCCCGGCAC
3.Reference Map information
Chrom Position Reference KM4
Chr1 32158 G K
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0011000000012 DQ3 K AAAGGTCTAGGCTCGCTGCTTGACGGAAGT TCGGGAGAGGTAATTGGAATCTCCCGGCAC 2014-07-19 2014-07-19
snp_cf0072000000007 YJ3 K AAAGGTCTAGGCTCGCTGCTTGACGGAAGT TCGGGAGAGGTAATTGGAATCTCCCGGCAC 2014-07-19 2014-07-19
snp_cf0015000000011 DQ7 K AAAGGTCTAGGCTCGCTGCTTGACGGAAGT TCGGGAGAGGTAATTGGAATCTCCCGGCAC 2014-07-19 2014-07-19
snp_cf0030000000006 GS6 K AAAGGTCTAGGCTCGCTGCTTGACGGAAGT TCGGGAGAGGTAATTGGAATCTCCCGGCAC 2014-07-19 2014-07-19
snp_cf0033000000006 GS9 K AAAGGTCTAGGCTCGCTGCTTGACGGAAGT TCGGGAGAGGTAATTGGAATCTCCCGGCAC 2014-07-19 2014-07-19
snp_cf0076000000009 YJ7 K AAAGGTCTAGGCTCGCTGCTTGACGGAAGT TCGGGAGAGGTAATTGGAATCTCCCGGCAC 2014-07-19 2014-07-19
6.Fasta Information
GCAGGTACCT TTCGCTTCCA AAAGGTCTAG GCTCGCTGCT TGACGGAAGT
K
TCGGGAGAGG TAATTGGAAT CTCCCGGCAC ACAAGACGAG TGCCTCCAAG