e.g. 1:1246..9423
SNP Detail For snp_cf0039002309055    [See in GBrowse]
1.General Information
SNP ID: snp_cf0039002309055
Organism: Canis familiaris
Individual: KM4
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: GGGTCTGGCTCCGTGACCCGAGTGCCCCCG
3'flank: GCACGAGGCTGCCGCGCGGTGTCCTCCGCC
3.Reference Map information
Chrom Position Reference KM4
Chr3 244442 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000031549 637 - G intron
ENSCAFG00000029754 191 + G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000048180 191 GGG => GAG ENSCAFP00000037937 64 G => E
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0027002162525 GS3 R GGGTCTGGCTCCGTGACCCGAGTGCCCCCG GCACGAGGCTGCCGCGCGGTGTCCTCCGCC 2014-07-19 2014-07-19
snp_cf0055003439368 LUPWCHN00001 A GGGTCTGGCTCCGTGACCCGAGTGCCCCCG GCACGAGGCTGCCGCGCGGTGTCCTCCGCC 2014-07-19 2014-07-19
snp_cf0057003280165 LUPWRUS00002 A GGGTCTGGCTCCGTGACCCGAGTGCCCCCG GCACGAGGCTGCCGCGCGGTGTCCTCCGCC 2014-07-19 2014-07-19
snp_cf0056003442073 LUPWRUS00001 R GGGTCTGGCTCCGTGACCCGAGTGCCCCCG GCACGAGGCTGCCGCGCGGTGTCCTCCGCC 2014-07-19 2014-07-19
snp_cf0042002897218 KM7 R GGGTCTGGCTCCGTGACCCGAGTGCCCCCG GCACGAGGCTGCCGCGCGGTGTCCTCCGCC 2014-07-19 2014-07-19
snp_cf0035002693482 KM10 R GGGTCTGGCTCCGTGACCCGAGTGCCCCCG GCACGAGGCTGCCGCGCGGTGTCCTCCGCC 2014-07-19 2014-07-19
snp_cf0008002790785 DQ10 R GGGTCTGGCTCCGTGACCCGAGTGCCCCCG GCACGAGGCTGCCGCGCGGTGTCCTCCGCC 2014-07-19 2014-07-19
snp_cf0048002623226 LJ3 A GGGTCTGGCTCCGTGACCCGAGTGCCCCCG GCACGAGGCTGCCGCGCGGTGTCCTCCGCC 2014-07-19 2014-07-19
snp_cf0043002321837 KM8 R GGGTCTGGCTCCGTGACCCGAGTGCCCCCG GCACGAGGCTGCCGCGCGGTGTCCTCCGCC 2014-07-19 2014-07-19
snp_cf0078002833883 YJ9 R GGGTCTGGCTCCGTGACCCGAGTGCCCCCG GCACGAGGCTGCCGCGCGGTGTCCTCCGCC 2014-07-19 2014-07-19
snp_cf0044002450400 KM9 R GGGTCTGGCTCCGTGACCCGAGTGCCCCCG GCACGAGGCTGCCGCGCGGTGTCCTCCGCC 2014-07-19 2014-07-19
snp_cf0018002312678 FAMBBEM00001 R GGGTCTGGCTCCGTGACCCGAGTGCCCCCG GCACGAGGCTGCCGCGCGGTGTCCTCCGCC 2014-07-19 2014-07-19
snp_cf0016002781579 DQ8 R GGGTCTGGCTCCGTGACCCGAGTGCCCCCG GCACGAGGCTGCCGCGCGGTGTCCTCCGCC 2014-07-19 2014-07-19
snp_cf0028002090649 GS4 A GGGTCTGGCTCCGTGACCCGAGTGCCCCCG GCACGAGGCTGCCGCGCGGTGTCCTCCGCC 2014-07-19 2014-07-19
snp_cf0021002661569 FAMICHN00001 R GGGTCTGGCTCCGTGACCCGAGTGCCCCCG GCACGAGGCTGCCGCGCGGTGTCCTCCGCC 2014-07-19 2014-07-19
snp_cf0076002854787 YJ7 A GGGTCTGGCTCCGTGACCCGAGTGCCCCCG GCACGAGGCTGCCGCGCGGTGTCCTCCGCC 2014-07-19 2014-07-19
snp_cf0038002211156 KM3 R GGGTCTGGCTCCGTGACCCGAGTGCCCCCG GCACGAGGCTGCCGCGCGGTGTCCTCCGCC 2014-07-19 2014-07-19
snp_cf0031002182737 GS7 R GGGTCTGGCTCCGTGACCCGAGTGCCCCCG GCACGAGGCTGCCGCGCGGTGTCCTCCGCC 2014-07-19 2014-07-19
snp_cf0013002702227 DQ5 R GGGTCTGGCTCCGTGACCCGAGTGCCCCCG GCACGAGGCTGCCGCGCGGTGTCCTCCGCC 2014-07-19 2014-07-19
snp_cf0019002150707 FAMBGSD00001 R GGGTCTGGCTCCGTGACCCGAGTGCCCCCG GCACGAGGCTGCCGCGCGGTGTCCTCCGCC 2014-07-19 2014-07-19
snp_cf0009002768604 DQ1 R GGGTCTGGCTCCGTGACCCGAGTGCCCCCG GCACGAGGCTGCCGCGCGGTGTCCTCCGCC 2014-07-19 2014-07-19
snp_cf0062002776877 TM3 R GGGTCTGGCTCCGTGACCCGAGTGCCCCCG GCACGAGGCTGCCGCGCGGTGTCCTCCGCC 2014-07-19 2014-07-19
snp_cf0036002205050 KM1 R GGGTCTGGCTCCGTGACCCGAGTGCCCCCG GCACGAGGCTGCCGCGCGGTGTCCTCCGCC 2014-07-19 2014-07-19
snp_cf0049002799333 LJ4 R GGGTCTGGCTCCGTGACCCGAGTGCCCCCG GCACGAGGCTGCCGCGCGGTGTCCTCCGCC 2014-07-19 2014-07-19
snp_cf0011002813216 DQ3 R GGGTCTGGCTCCGTGACCCGAGTGCCCCCG GCACGAGGCTGCCGCGCGGTGTCCTCCGCC 2014-07-19 2014-07-19
snp_cf0012002758583 DQ4 R GGGTCTGGCTCCGTGACCCGAGTGCCCCCG GCACGAGGCTGCCGCGCGGTGTCCTCCGCC 2014-07-19 2014-07-19
6.Fasta Information
CCCCTTACTC TGCTCCCTGC GGGTCTGGCT CCGTGACCCG AGTGCCCCCG
R
GCACGAGGCT GCCGCGCGGT GTCCTCCGCC GGGGGCCGGG CAGCCCGCAG