e.g. 1:1246..9423
SNP Detail For snp_cf0039002309065    [See in GBrowse]
1.General Information
SNP ID: snp_cf0039002309065
Organism: Canis familiaris
Individual: KM4
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: AACATGCTTTTGTGCCTGTAACCTGTTTTG
3'flank: GAGGGAAGGAGTTTGTAGACGGGGAGTTGA
3.Reference Map information
Chrom Position Reference KM4
Chr3 256756 T Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000007343 9682 - T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000011749 3147 TCA => TCG ENSCAFP00000010888 1049 S => S
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0070002925738 YJ1 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0041002780756 KM6 Y AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0030002160362 GS6 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0077002822154 YJ8 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0010002775158 DQ2 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0037002336713 KM2 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0001001252435 solidGW1 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-08-01 2014-08-01
snp_cf0006003194479 CRW C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0009002768617 DQ1 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0014002747739 DQ6 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0028002090661 GS4 Y AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0062002776888 TM3 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0051002760996 LJ6 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0068002726631 TM9 Y AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0052002717233 LJ7 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0002001843127 CID1 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-08-02 2014-08-02
snp_cf0064002793021 TM5 Y AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0027002162536 GS3 Y AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0060002710764 TM1 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0078002833892 YJ9 Y AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0029002053913 GS5 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0032002158871 GS8 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0033002195112 GS9 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0007002376664 Dingo C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0072002836870 YJ3 Y AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0045002507156 LJ10 Y AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0017002805986 DQ9 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0065002761531 TM6 Y AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0004002308955 Basenji C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0038002211168 KM3 Y AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0031002182748 GS7 Y AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0019002150717 FAMBGSD00001 Y AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0013002702237 DQ5 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0053002703011 LJ8 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0024002200124 GS10 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0056003442091 LUPWRUS00001 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0036002205060 KM1 Y AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0067002744819 TM8 Y AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0005003271681 CHW Y AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0049002799346 LJ4 Y AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0020002751179 FAMBTIM00001 Y AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0058003431811 LUPWRUS00003 Y AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0071002835520 YJ2 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0073002770876 YJ4 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0059002779614 TM10 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0047002687797 LJ2 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0012002758594 DQ4 Y AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0066002835978 TM7 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0046002570235 LJ1 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0075002839474 YJ6 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0025002178794 GS1 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0061002812667 TM2 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0057003280176 LUPWRUS00002 Y AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0042002897227 KM7 Y AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0034003201150 ISW C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0011002813222 DQ3 Y AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0008002790797 DQ10 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0048002623237 LJ3 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0016002781585 DQ8 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0063002738481 TM4 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0050002559569 LJ5 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0021002661579 FAMICHN00001 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0040002412070 KM5 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0022002436777 FAMICHN00002 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0026002153720 GS2 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0015002740503 DQ7 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0054002503156 LJ9 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0023002652088 FAMICHN00003 Y AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0074002807016 YJ5 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0069002864121 YJ10 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
snp_cf0055003439386 LUPWCHN00001 C AACATGCTTTTGTGCCTGTAACCTGTTTTG GAGGGAAGGAGTTTGTAGACGGGGAGTTGA 2014-07-19 2014-07-19
6.Fasta Information
TCCTCTCCTG GGGTGAAGCT AACATGCTTT TGTGCCTGTA ACCTGTTTTG
Y
GAGGGAAGGA GTTTGTAGAC GGGGAGTTGA CTTGGCTTCC TTGCCACAGG