e.g. 1:1246..9423
SNP Detail For snp_cf0039002309434    [See in GBrowse]
1.General Information
SNP ID: snp_cf0039002309434
Organism: Canis familiaris
Individual: KM4
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: GCGAGACGCAGCGCTGGGCGCGCGGGTTTA
3'flank: GGCCCACGGATGGGCAGTGCGGCGGGGCTC
3.Reference Map information
Chrom Position Reference KM4
Chr3 689080 A R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000029713 709 + A CDS
ENSCAFG00000031575 785 - A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000044936 709 AGG => GGG ENSCAFP00000041420 237 R => G
- ENSCAFT00000043231 785 CTT => CCT ENSCAFP00000036716 262 L => P
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0071002835909 YJ2 G GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0038002211548 KM3 R GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0052002717624 LJ7 R GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0020002751518 FAMBTIM00001 G GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0033002195509 GS9 G GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0078002834395 YJ9 R GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0019002151068 FAMBGSD00001 G GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0028002091034 GS4 R GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0005003272155 CHW G GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0032002159232 GS8 G GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0065002761915 TM6 G GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0017002806522 DQ9 R GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0044002450607 KM9 R GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0041002781162 KM6 G GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0030002160725 GS6 G GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0031002183127 GS7 R GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0067002745187 TM8 R GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0013002702625 DQ5 R GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0036002205425 KM1 R GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0029002054296 GS5 G GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0059002780003 TM10 G GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0060002711134 TM1 G GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0026002154086 GS2 G GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0061002813056 TM2 G GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0049002799754 LJ4 R GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0068002727013 TM9 R GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0025002179154 GS1 G GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0076002855129 YJ7 R GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0066002836518 TM7 R GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0043002322052 KM8 R GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0009002769050 DQ1 R GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0042002897632 KM7 R GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0035002693683 KM10 R GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0001001252812 solidGW1 R GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-08-01 2014-08-01
snp_cf0024002200489 GS10 G GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0070002926293 YJ1 R GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0037002337076 KM2 G GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0062002777275 TM3 G GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0069002864511 YJ10 G GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0007002377021 Dingo G GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0040002412429 KM5 G GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0072002837350 YJ3 R GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0027002162913 GS3 R GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0063002738997 TM4 G GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0073002771414 YJ4 R GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0021002661971 FAMICHN00001 G GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0008002791202 DQ10 G GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0015002740945 DQ7 R GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
snp_cf0077002822579 YJ8 G GCGAGACGCAGCGCTGGGCGCGCGGGTTTA GGCCCACGGATGGGCAGTGCGGCGGGGCTC 2014-07-19 2014-07-19
6.Fasta Information
CCACTGGCCG CCAAGTTCTC GCGAGACGCA GCGCTGGGCG CGCGGGTTTA
R
GGCCCACGGA TGGGCAGTGC GGCGGGGCTC CGGAGGAAGG AGCACCGGGA