e.g. 1:1246..9423
SNP Detail For snp_cf0039002309435    [See in GBrowse]
1.General Information
SNP ID: snp_cf0039002309435
Organism: Canis familiaris
Individual: KM4
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: GGCCCTAGGAGGAAGGAGGACAGGGATTGG
3'flank: GGTGAGGCGGGACTTCGGGAGGAAAAAGGA
3.Reference Map information
Chrom Position Reference KM4
Chr3 689356 T Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000029713 985 + T CDS
ENSCAFG00000031575 509 - T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000044936 985 TGG => CGG ENSCAFP00000041420 329 W => R
- ENSCAFT00000043231 509 CAC => CGC ENSCAFP00000036716 170 H => R
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0064002793396 TM5 Y GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0052002717625 LJ7 Y GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0042002897633 KM7 Y GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0025002179155 GS1 C GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0035002693684 KM10 C GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0078002834396 YJ9 C GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0040002412430 KM5 C GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0028002091035 GS4 Y GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0049002799755 LJ4 Y GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0032002159233 GS8 C GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0024002200490 GS10 C GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0044002450608 KM9 Y GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0030002160726 GS6 C GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0070002926294 YJ1 C GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0026002154087 GS2 C GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0005003272156 CHW Y GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0041002781163 KM6 C GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0037002337077 KM2 C GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0065002761916 TM6 Y GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0062002777276 TM3 C GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0053002703345 LJ8 C GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0031002183128 GS7 Y GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0013002702626 DQ5 Y GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0069002864512 YJ10 C GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0072002837351 YJ3 C GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0029002054297 GS5 C GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0060002711135 TM1 C GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0061002813057 TM2 C GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0063002738998 TM4 C GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0051002761334 LJ6 C GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0021002661972 FAMICHN00001 C GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0011002813439 DQ3 Y GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0008002791203 DQ10 C GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0073002771415 YJ4 C GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0068002727014 TM9 Y GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0071002835910 YJ2 C GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0047002688115 LJ2 C GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0016002781824 DQ8 Y GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0015002740947 DQ7 C GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0075002839901 YJ6 C GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0066002836519 TM7 C GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0009002769051 DQ1 Y GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0033002195510 GS9 C GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
snp_cf0043002322053 KM8 Y GGCCCTAGGAGGAAGGAGGACAGGGATTGG GGTGAGGCGGGACTTCGGGAGGAAAAAGGA 2014-07-19 2014-07-19
6.Fasta Information
GAAGACCGGC GGTGGGGCGG GGCCCTAGGA GGAAGGAGGA CAGGGATTGG
Y
GGTGAGGCGG GACTTCGGGA GGAAAAAGGA TAGAGATAGG CAGGAGGGCC