e.g. 1:1246..9423
SNP Detail For snp_cf0039002309436    [See in GBrowse]
1.General Information
SNP ID: snp_cf0039002309436
Organism: Canis familiaris
Individual: KM4
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: TAGGAGGAAGGAGGACAGGGATTGGTGGTG
3'flank: GGCGGGACTTCGGGAGGAAAAAGGATAGAG
3.Reference Map information
Chrom Position Reference KM4
Chr3 689361 A R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000029713 990 + A CDS
ENSCAFG00000031575 504 - A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000044936 990 TGA => TGG ENSCAFP00000041420 330 stop_codon => W
- ENSCAFT00000043231 504 CCT => CCC ENSCAFP00000036716 168 P => P
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0064002793397 TM5 R TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0052002717626 LJ7 R TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0025002179156 GS1 G TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0001001252813 solidGW1 R TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-08-01 2014-08-01
snp_cf0042002897634 KM7 R TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0035002693685 KM10 G TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0019002151069 FAMBGSD00001 G TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0028002091036 GS4 R TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0040002412431 KM5 G TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0078002834397 YJ9 R TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0049002799756 LJ4 R TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0044002450609 KM9 R TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0024002200491 GS10 G TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0030002160727 GS6 G TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0070002926295 YJ1 G TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0026002154088 GS2 G TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0037002337078 KM2 G TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0041002781164 KM6 G TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0065002761917 TM6 R TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0032002159234 GS8 G TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0053002703346 LJ8 G TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0029002054298 GS5 G TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0062002777277 TM3 G TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0031002183129 GS7 R TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0013002702627 DQ5 R TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0069002864513 YJ10 G TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0072002837352 YJ3 G TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0036002205426 KM1 R TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0066002836520 TM7 G TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0060002711136 TM1 G TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0011002813440 DQ3 R TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0061002813058 TM2 G TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0063002738999 TM4 G TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0021002661973 FAMICHN00001 G TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0073002771416 YJ4 G TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0008002791204 DQ10 G TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0051002761335 LJ6 G TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0068002727015 TM9 R TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0016002781825 DQ8 R TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0015002740948 DQ7 G TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0071002835911 YJ2 G TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0047002688116 LJ2 G TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0043002322054 KM8 R TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0075002839902 YJ6 G TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0009002769052 DQ1 R TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
snp_cf0033002195511 GS9 G TAGGAGGAAGGAGGACAGGGATTGGTGGTG GGCGGGACTTCGGGAGGAAAAAGGATAGAG 2014-07-19 2014-07-19
6.Fasta Information
CCGGCGGTGG GGCGGGGCCC TAGGAGGAAG GAGGACAGGG ATTGGTGGTG
R
GGCGGGACTT CGGGAGGAAA AAGGATAGAG ATAGGCAGGA GGGCCGGACA