e.g. 1:1246..9423
SNP Detail For snp_cf0039002309549    [See in GBrowse]
1.General Information
SNP ID: snp_cf0039002309549
Organism: Canis familiaris
Individual: KM4
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs23536701  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: GGCAGCAGTGAACTCCACGCCGCAGGCACC
3'flank: GTTACCTCCACTCTTTTTAATCGTCACACC
3.Reference Map information
Chrom Position Reference KM4
Chr3 1023567 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000029015 4262 + A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000044180 184 AGT => GGT ENSCAFP00000041013 62 S => G
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0066002836851 TM7 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0075002840199 YJ6 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0007002377279 Dingo G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0026002154191 GS2 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0052002717905 LJ7 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0065002762208 TM6 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0023002652837 FAMICHN00003 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0078002834745 YJ9 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0051002761601 LJ6 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0063002739361 TM4 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0005003272593 CHW G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0011002813764 DQ3 R GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0077002822861 YJ8 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0021002662331 FAMICHN00001 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0033002195787 GS9 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0076002855410 YJ7 R GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0059002780280 TM10 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0042002897880 KM7 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0043002322380 KM8 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0069002864776 YJ10 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0002001843604 CID1 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-08-02 2014-08-02
snp_cf0070002926636 YJ1 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0035002693971 KM10 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0027002163022 GS3 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0028002091148 GS4 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0022002437297 FAMICHN00002 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0041002781450 KM6 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0057003280916 LUPWRUS00002 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0015002741339 DQ7 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0046002570936 LJ1 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0037002337183 KM2 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0031002183241 GS7 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0068002727297 TM9 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0049002800115 LJ4 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0056003442855 LUPWRUS00001 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0058003432313 LUPWRUS00003 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0034003201842 ISW G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0025002179259 GS1 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0050002560070 LJ5 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0040002412537 KM5 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0036002205536 KM1 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0009002769321 DQ1 R GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0061002813327 TM2 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0071002836180 YJ2 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0001001253021 solidGW1 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-08-01 2014-08-01
snp_cf0064002793677 TM5 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0048002623948 LJ3 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0006003195146 CRW G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0053002703608 LJ8 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0008002791479 DQ10 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0017002806862 DQ9 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0019002151175 FAMBGSD00001 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0032002159338 GS8 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0067002745468 TM8 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0013002702880 DQ5 R GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0062002777553 TM3 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0004002309611 Basenji G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0012002758878 DQ4 R GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0020002751628 FAMBTIM00001 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0045002507607 LJ10 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0047002688420 LJ2 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0018002313283 FAMBBEM00001 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0016002782160 DQ8 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0060002711392 TM1 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0024002200596 GS10 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0054002503716 LJ9 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0072002837749 YJ3 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0044002450935 KM9 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0030002160830 GS6 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0029002054543 GS5 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0055003440208 LUPWCHN00001 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0038002211660 KM3 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0003001590228 dbSNP139 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0073002771819 YJ4 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
snp_cf0074002807731 YJ5 G GGCAGCAGTGAACTCCACGCCGCAGGCACC GTTACCTCCACTCTTTTTAATCGTCACACC 2014-07-19 2014-07-19
6.Fasta Information
TGGCCTCCCT GACTCCACCT GGCAGCAGTG AACTCCACGC CGCAGGCACC
G
GTTACCTCCA CTCTTTTTAA TCGTCACACC TCCATTTGTA TTACATATGG