e.g. 1:1246..9423
SNP Detail For snp_cf0039002309737    [See in GBrowse]
1.General Information
SNP ID: snp_cf0039002309737
Organism: Canis familiaris
Individual: KM4
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs23629805  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: TGGCAGCATTTCCATCAGCATCTTCAACGT
3'flank: CCCTGCGGCCTGTACCTTCATCAGCTCAGC
3.Reference Map information
Chrom Position Reference KM4
Chr3 1181619 C T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000007379 187960 - C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000011821 1204 GAC => AAC ENSCAFP00000010959 402 D => N
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0052002718117 LJ7 Y TGGCAGCATTTCCATCAGCATCTTCAACGT CCCTGCGGCCTGTACCTTCATCAGCTCAGC 2014-07-19 2014-07-19
snp_cf0047002688597 LJ2 Y TGGCAGCATTTCCATCAGCATCTTCAACGT CCCTGCGGCCTGTACCTTCATCAGCTCAGC 2014-07-19 2014-07-19
snp_cf0059002780497 TM10 Y TGGCAGCATTTCCATCAGCATCTTCAACGT CCCTGCGGCCTGTACCTTCATCAGCTCAGC 2014-07-19 2014-07-19
snp_cf0030002161011 GS6 T TGGCAGCATTTCCATCAGCATCTTCAACGT CCCTGCGGCCTGTACCTTCATCAGCTCAGC 2014-07-19 2014-07-19
snp_cf0028002091335 GS4 T TGGCAGCATTTCCATCAGCATCTTCAACGT CCCTGCGGCCTGTACCTTCATCAGCTCAGC 2014-07-19 2014-07-19
snp_cf0026002154372 GS2 T TGGCAGCATTTCCATCAGCATCTTCAACGT CCCTGCGGCCTGTACCTTCATCAGCTCAGC 2014-07-19 2014-07-19
snp_cf0038002211846 KM3 T TGGCAGCATTTCCATCAGCATCTTCAACGT CCCTGCGGCCTGTACCTTCATCAGCTCAGC 2014-07-19 2014-07-19
snp_cf0025002179438 GS1 T TGGCAGCATTTCCATCAGCATCTTCAACGT CCCTGCGGCCTGTACCTTCATCAGCTCAGC 2014-07-19 2014-07-19
snp_cf0054002503868 LJ9 Y TGGCAGCATTTCCATCAGCATCTTCAACGT CCCTGCGGCCTGTACCTTCATCAGCTCAGC 2014-07-19 2014-07-19
snp_cf0012002759061 DQ4 Y TGGCAGCATTTCCATCAGCATCTTCAACGT CCCTGCGGCCTGTACCTTCATCAGCTCAGC 2014-07-19 2014-07-19
snp_cf0051002761788 LJ6 Y TGGCAGCATTTCCATCAGCATCTTCAACGT CCCTGCGGCCTGTACCTTCATCAGCTCAGC 2014-07-19 2014-07-19
snp_cf0016002782365 DQ8 Y TGGCAGCATTTCCATCAGCATCTTCAACGT CCCTGCGGCCTGTACCTTCATCAGCTCAGC 2014-07-19 2014-07-19
snp_cf0040002412717 KM5 T TGGCAGCATTTCCATCAGCATCTTCAACGT CCCTGCGGCCTGTACCTTCATCAGCTCAGC 2014-07-19 2014-07-19
snp_cf0003001590335 dbSNP139 T TGGCAGCATTTCCATCAGCATCTTCAACGT CCCTGCGGCCTGTACCTTCATCAGCTCAGC 2014-07-19 2014-07-19
snp_cf0041002781666 KM6 Y TGGCAGCATTTCCATCAGCATCTTCAACGT CCCTGCGGCCTGTACCTTCATCAGCTCAGC 2014-07-19 2014-07-19
snp_cf0032002159519 GS8 T TGGCAGCATTTCCATCAGCATCTTCAACGT CCCTGCGGCCTGTACCTTCATCAGCTCAGC 2014-07-19 2014-07-19
snp_cf0042002898095 KM7 Y TGGCAGCATTTCCATCAGCATCTTCAACGT CCCTGCGGCCTGTACCTTCATCAGCTCAGC 2014-07-19 2014-07-19
snp_cf0053002703800 LJ8 Y TGGCAGCATTTCCATCAGCATCTTCAACGT CCCTGCGGCCTGTACCTTCATCAGCTCAGC 2014-07-19 2014-07-19
snp_cf0020002751809 FAMBTIM00001 T TGGCAGCATTTCCATCAGCATCTTCAACGT CCCTGCGGCCTGTACCTTCATCAGCTCAGC 2014-07-19 2014-07-19
snp_cf0006003195237 CRW Y TGGCAGCATTTCCATCAGCATCTTCAACGT CCCTGCGGCCTGTACCTTCATCAGCTCAGC 2014-07-19 2014-07-19
snp_cf0031002183428 GS7 T TGGCAGCATTTCCATCAGCATCTTCAACGT CCCTGCGGCCTGTACCTTCATCAGCTCAGC 2014-07-19 2014-07-19
snp_cf0033002196009 GS9 Y TGGCAGCATTTCCATCAGCATCTTCAACGT CCCTGCGGCCTGTACCTTCATCAGCTCAGC 2014-07-19 2014-07-19
snp_cf0024002200777 GS10 T TGGCAGCATTTCCATCAGCATCTTCAACGT CCCTGCGGCCTGTACCTTCATCAGCTCAGC 2014-07-19 2014-07-19
snp_cf0036002205722 KM1 T TGGCAGCATTTCCATCAGCATCTTCAACGT CCCTGCGGCCTGTACCTTCATCAGCTCAGC 2014-07-19 2014-07-19
snp_cf0027002163209 GS3 T TGGCAGCATTTCCATCAGCATCTTCAACGT CCCTGCGGCCTGTACCTTCATCAGCTCAGC 2014-07-19 2014-07-19
snp_cf0077002823079 YJ8 Y TGGCAGCATTTCCATCAGCATCTTCAACGT CCCTGCGGCCTGTACCTTCATCAGCTCAGC 2014-07-19 2014-07-19
snp_cf0019002151357 FAMBGSD00001 T TGGCAGCATTTCCATCAGCATCTTCAACGT CCCTGCGGCCTGTACCTTCATCAGCTCAGC 2014-07-19 2014-07-19
snp_cf0062002777768 TM3 Y TGGCAGCATTTCCATCAGCATCTTCAACGT CCCTGCGGCCTGTACCTTCATCAGCTCAGC 2014-07-19 2014-07-19
snp_cf0037002337364 KM2 T TGGCAGCATTTCCATCAGCATCTTCAACGT CCCTGCGGCCTGTACCTTCATCAGCTCAGC 2014-07-19 2014-07-19
snp_cf0045002507751 LJ10 Y TGGCAGCATTTCCATCAGCATCTTCAACGT CCCTGCGGCCTGTACCTTCATCAGCTCAGC 2014-07-19 2014-07-19
6.Fasta Information
GGGCACCATG TTGGTGGCCT TGGCAGCATT TCCATCAGCA TCTTCAACGT
T
CCCTGCGGCC TGTACCTTCA TCAGCTCAGC CTCTGCCCCC TCGACTGCCA