e.g. 1:1246..9423
SNP Detail For snp_cf0039001054943    [See in GBrowse]
1.General Information
SNP ID: snp_cf0039001054943
Organism: Canis familiaris
Individual: KM4
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: CCTCACTGTCAGTAGCCAGCACCTTGCGTG
3'flank: GGAGCTTTCAGCTGACTTTTTACCCTTTGG
3.Reference Map information
Chrom Position Reference KM4
Chr18 53847 C T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000014138 19994 - C intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0065001283938 TM6 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0035001262688 KM10 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0007001118051 Dingo Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0030001026728 GS6 T CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0027001014700 GS3 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0028000963637 GS4 T CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0022001179766 FAMICHN00002 T CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0016001303869 DQ8 T CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0070001382993 YJ1 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0014001292844 DQ6 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0033001016193 GS9 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0019001006621 FAMBGSD00001 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0064001316989 TM5 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0059001306419 TM10 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0011001329106 DQ3 T CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0031001014379 GS7 T CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0072001343451 YJ3 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0043001090717 KM8 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0012001303206 DQ4 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0052001274020 LJ7 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0062001317907 TM3 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0078001336339 YJ9 T CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0010001288731 DQ2 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0040001165026 KM5 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0060001300081 TM1 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0075001339764 YJ6 T CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0009001308184 DQ1 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0026001001688 GS2 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0063001287684 TM4 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0068001257995 TM9 T CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0051001306366 LJ6 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0029000943872 GS5 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0037001102110 KM2 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0024001052810 GS10 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0054001168577 LJ9 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0077001325199 YJ8 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0041001311122 KM6 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0032001009624 GS8 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0025001007445 GS1 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0066001336084 TM7 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0050001214286 LJ5 T CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0069001349626 YJ10 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0017001318517 DQ9 T CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0013001252374 DQ5 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0042001356720 KM7 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
snp_cf0045001182662 LJ10 Y CCTCACTGTCAGTAGCCAGCACCTTGCGTG GGAGCTTTCAGCTGACTTTTTACCCTTTGG 2014-07-19 2014-07-19
6.Fasta Information
ATAGAACATC CACCCAAGTG CCTCACTGTC AGTAGCCAGC ACCTTGCGTG
T
GGAGCTTTCA GCTGACTTTT TACCCTTTGG CTCCTAAATG CAACAGAAAA