e.g. 1:1246..9423
SNP Detail For snp_cf0039001054945    [See in GBrowse]
1.General Information
SNP ID: snp_cf0039001054945
Organism: Canis familiaris
Individual: KM4
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: ATGCTAAGCCACCGGGGCTGCCCCCCCCCC
3'flank: TTTTTTTGTTTTATTTCTTTATTTGAGAGA
3.Reference Map information
Chrom Position Reference KM4
Chr18 59060 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000014138 14781 - C intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0059001306422 TM10 Y ATGCTAAGCCACCGGGGCTGCCCCCCCCCC TTTTTTTGTTTTATTTCTTTATTTGAGAGA 2014-07-19 2014-07-19
snp_cf0017001318519 DQ9 Y ATGCTAAGCCACCGGGGCTGCCCCCCCCCC TTTTTTTGTTTTATTTCTTTATTTGAGAGA 2014-07-19 2014-07-19
snp_cf0001000557538 solidGW1 T ATGCTAAGCCACCGGGGCTGCCCCCCCCCC TTTTTTTGTTTTATTTCTTTATTTGAGAGA 2014-08-01 2014-08-01
snp_cf0043001090720 KM8 Y ATGCTAAGCCACCGGGGCTGCCCCCCCCCC TTTTTTTGTTTTATTTCTTTATTTGAGAGA 2014-07-19 2014-07-19
snp_cf0028000963639 GS4 Y ATGCTAAGCCACCGGGGCTGCCCCCCCCCC TTTTTTTGTTTTATTTCTTTATTTGAGAGA 2014-07-19 2014-07-19
snp_cf0036001008619 KM1 Y ATGCTAAGCCACCGGGGCTGCCCCCCCCCC TTTTTTTGTTTTATTTCTTTATTTGAGAGA 2014-07-19 2014-07-19
snp_cf0016001303871 DQ8 Y ATGCTAAGCCACCGGGGCTGCCCCCCCCCC TTTTTTTGTTTTATTTCTTTATTTGAGAGA 2014-07-19 2014-07-19
snp_cf0055001635369 LUPWCHN00001 T ATGCTAAGCCACCGGGGCTGCCCCCCCCCC TTTTTTTGTTTTATTTCTTTATTTGAGAGA 2014-07-19 2014-07-19
snp_cf0029000943874 GS5 Y ATGCTAAGCCACCGGGGCTGCCCCCCCCCC TTTTTTTGTTTTATTTCTTTATTTGAGAGA 2014-07-19 2014-07-19
snp_cf0040001165029 KM5 Y ATGCTAAGCCACCGGGGCTGCCCCCCCCCC TTTTTTTGTTTTATTTCTTTATTTGAGAGA 2014-07-19 2014-07-19
snp_cf0076001348931 YJ7 Y ATGCTAAGCCACCGGGGCTGCCCCCCCCCC TTTTTTTGTTTTATTTCTTTATTTGAGAGA 2014-07-19 2014-07-19
snp_cf0035001262692 KM10 Y ATGCTAAGCCACCGGGGCTGCCCCCCCCCC TTTTTTTGTTTTATTTCTTTATTTGAGAGA 2014-07-19 2014-07-19
snp_cf0051001306368 LJ6 Y ATGCTAAGCCACCGGGGCTGCCCCCCCCCC TTTTTTTGTTTTATTTCTTTATTTGAGAGA 2014-07-19 2014-07-19
snp_cf0068001257997 TM9 Y ATGCTAAGCCACCGGGGCTGCCCCCCCCCC TTTTTTTGTTTTATTTCTTTATTTGAGAGA 2014-07-19 2014-07-19
snp_cf0020001295548 FAMBTIM00001 T ATGCTAAGCCACCGGGGCTGCCCCCCCCCC TTTTTTTGTTTTATTTCTTTATTTGAGAGA 2014-07-19 2014-07-19
snp_cf0026001001690 GS2 Y ATGCTAAGCCACCGGGGCTGCCCCCCCCCC TTTTTTTGTTTTATTTCTTTATTTGAGAGA 2014-07-19 2014-07-19
snp_cf0032001009626 GS8 Y ATGCTAAGCCACCGGGGCTGCCCCCCCCCC TTTTTTTGTTTTATTTCTTTATTTGAGAGA 2014-07-19 2014-07-19
snp_cf0009001308188 DQ1 Y ATGCTAAGCCACCGGGGCTGCCCCCCCCCC TTTTTTTGTTTTATTTCTTTATTTGAGAGA 2014-07-19 2014-07-19
snp_cf0005001579741 CHW Y ATGCTAAGCCACCGGGGCTGCCCCCCCCCC TTTTTTTGTTTTATTTCTTTATTTGAGAGA 2014-07-19 2014-07-19
snp_cf0058001636868 LUPWRUS00003 Y ATGCTAAGCCACCGGGGCTGCCCCCCCCCC TTTTTTTGTTTTATTTCTTTATTTGAGAGA 2014-07-19 2014-07-19
snp_cf0050001214289 LJ5 Y ATGCTAAGCCACCGGGGCTGCCCCCCCCCC TTTTTTTGTTTTATTTCTTTATTTGAGAGA 2014-07-19 2014-07-19
snp_cf0065001283941 TM6 Y ATGCTAAGCCACCGGGGCTGCCCCCCCCCC TTTTTTTGTTTTATTTCTTTATTTGAGAGA 2014-07-19 2014-07-19
snp_cf0057001567262 LUPWRUS00002 T ATGCTAAGCCACCGGGGCTGCCCCCCCCCC TTTTTTTGTTTTATTTCTTTATTTGAGAGA 2014-07-19 2014-07-19
snp_cf0069001349628 YJ10 Y ATGCTAAGCCACCGGGGCTGCCCCCCCCCC TTTTTTTGTTTTATTTCTTTATTTGAGAGA 2014-07-19 2014-07-19
snp_cf0064001316992 TM5 Y ATGCTAAGCCACCGGGGCTGCCCCCCCCCC TTTTTTTGTTTTATTTCTTTATTTGAGAGA 2014-07-19 2014-07-19
6.Fasta Information
GGGCCAAAGG CAGCGCTAAA ATGCTAAGCC ACCGGGGCTG CCCCCCCCCC
Y
TTTTTTTGTT TTATTTCTTT ATTTGAGAGA GAGAGCATGA GCAGGAAGGG