e.g. 1:1246..9423
SNP Detail For snp_cf0039001054947    [See in GBrowse]
1.General Information
SNP ID: snp_cf0039001054947
Organism: Canis familiaris
Individual: KM4
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: AGTGGGTTTCTGTGGCAAGCTTTATGGAGG
3'flank: AAGCTGCTGTCAGGGAATGTTGAGGAGGAG
3.Reference Map information
Chrom Position Reference KM4
Chr18 61810 C T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000014138 12031 - C intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0062001317912 TM3 T AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0059001306424 TM10 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0070001382998 YJ1 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0025001007448 GS1 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0009001308190 DQ1 T AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0043001090722 KM8 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0005001579749 CHW T AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0037001102114 KM2 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0072001343454 YJ3 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0002000858944 CID1 T AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-08-02 2014-08-02
snp_cf0033001016197 GS9 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0054001168581 LJ9 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0016001303873 DQ8 T AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0028000963641 GS4 T AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0001000557540 solidGW1 T AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-08-01 2014-08-01
snp_cf0011001329109 DQ3 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0050001214291 LJ5 T AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0056001650350 LUPWRUS00001 T AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0010001288736 DQ2 T AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0060001300084 TM1 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0065001283943 TM6 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0069001349630 YJ10 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0076001348933 YJ7 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0029000943877 GS5 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0073001292828 YJ4 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0077001325204 YJ8 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0035001262694 KM10 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0052001274024 LJ7 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0063001287688 TM4 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0042001356724 KM7 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0030001026731 GS6 T AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0051001306370 LJ6 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0032001009628 GS8 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0057001567265 LUPWRUS00002 T AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0078001336342 YJ9 T AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0067001279425 TM8 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0041001311126 KM6 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0055001635371 LUPWCHN00001 T AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0047001265456 LJ2 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0020001295550 FAMBTIM00001 T AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0040001165031 KM5 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0022001179769 FAMICHN00002 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0027001014704 GS3 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0014001292848 DQ6 T AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0019001006625 FAMBGSD00001 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0017001318521 DQ9 T AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0034001539162 ISW T AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0061001325513 TM2 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0075001339767 YJ6 T AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0068001257999 TM9 T AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0026001001692 GS2 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0024001052814 GS10 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0066001336088 TM7 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0031001014382 GS7 T AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0013001252379 DQ5 T AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0058001636869 LUPWRUS00003 T AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0012001303211 DQ4 T AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0064001316994 TM5 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0015001305534 DQ7 Y AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
snp_cf0006001514529 CRW T AGTGGGTTTCTGTGGCAAGCTTTATGGAGG AAGCTGCTGTCAGGGAATGTTGAGGAGGAG 2014-07-19 2014-07-19
6.Fasta Information
CAAATGATTA AAAAAAAAAA AGTGGGTTTC TGTGGCAAGC TTTATGGAGG
T
AAGCTGCTGT CAGGGAATGT TGAGGAGGAG GACAAAGCCA CAGAGCAGCC