e.g. 1:1246..9423
SNP Detail For snp_cf0039001054949    [See in GBrowse]
1.General Information
SNP ID: snp_cf0039001054949
Organism: Canis familiaris
Individual: KM4
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: A
5'flank: TCCGAGGGTCATCCTTCAGCCCACCGCAGG
3'flank: ACCACCCATGGGCCGCCGGGAAATCGCTCC
3.Reference Map information
Chrom Position Reference KM4
Chr18 63688 G A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000014138 10153 - G intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0063001287690 TM4 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0007001118055 Dingo R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0011001329111 DQ3 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0062001317916 TM3 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0027001014706 GS3 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0040001165033 KM5 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0078001336344 YJ9 A TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0059001306426 TM10 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0012001303215 DQ4 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0055001635372 LUPWCHN00001 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0009001308194 DQ1 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0010001288740 DQ2 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0043001090724 KM8 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0026001001694 GS2 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0070001383001 YJ1 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0037001102116 KM2 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0025001007450 GS1 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0028000963643 GS4 A TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0072001343456 YJ3 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0016001303875 DQ8 A TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0068001258001 TM9 A TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0066001336090 TM7 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0013001252383 DQ5 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0017001318523 DQ9 A TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0001000557541 solidGW1 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-08-01 2014-08-01
snp_cf0060001300087 TM1 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0056001650351 LUPWRUS00001 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0022001179770 FAMICHN00002 A TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0029000943879 GS5 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0065001283945 TM6 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0069001349632 YJ10 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0033001016199 GS9 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0005001579759 CHW R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0019001006627 FAMBGSD00001 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0052001274026 LJ7 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0077001325206 YJ8 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0032001009630 GS8 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0014001292853 DQ6 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0075001339769 YJ6 A TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0035001262696 KM10 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0030001026733 GS6 A TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0024001052816 GS10 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0051001306372 LJ6 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0031001014384 GS7 A TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0042001356726 KM7 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0064001316996 TM5 A TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
snp_cf0041001311128 KM6 R TCCGAGGGTCATCCTTCAGCCCACCGCAGG ACCACCCATGGGCCGCCGGGAAATCGCTCC 2014-07-19 2014-07-19
6.Fasta Information
CTCAGGCCAG GCACCCAGCT TCCGAGGGTC ATCCTTCAGC CCACCGCAGG
A
ACCACCCATG GGCCGCCGGG AAATCGCTCC CCGCCCTCCT CTGCTGACCA