e.g. 1:1246..9423
SNP Detail For snp_cf0039001054950    [See in GBrowse]
1.General Information
SNP ID: snp_cf0039001054950
Organism: Canis familiaris
Individual: KM4
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs8530790  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: TGCACTGCGCCTGTGGATGGATGCCCGCAG
3'flank: GCTGACTTCCCTGAGAACTCTGGGAGTCCC
3.Reference Map information
Chrom Position Reference KM4
Chr18 64779 G C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000014138 9062 - G intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0012001303218 DQ4 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0043001090725 KM8 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0010001288743 DQ2 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0011001329112 DQ3 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0073001292833 YJ4 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0044001156238 KM9 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0009001308197 DQ1 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0029000943880 GS5 S TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0028000963644 GS4 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0070001383002 YJ1 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0032001009631 GS8 S TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0025001007451 GS1 S TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0072001343457 YJ3 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0003000735593 dbSNP139 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0037001102117 KM2 S TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0013001252386 DQ5 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0066001336091 TM7 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0062001317919 TM3 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0001000557543 solidGW1 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-08-01 2014-08-01
snp_cf0060001300088 TM1 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0035001262697 KM10 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0056001650352 LUPWRUS00001 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0018001095181 FAMBBEM00001 S TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0069001349633 YJ10 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0022001179771 FAMICHN00002 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0065001283946 TM6 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0052001274027 LJ7 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0076001348937 YJ7 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0077001325207 YJ8 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0019001006628 FAMBGSD00001 S TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0002000858949 CID1 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-08-02 2014-08-02
snp_cf0004001085558 Basenji C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0014001292856 DQ6 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0030001026734 GS6 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0051001306373 LJ6 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0042001356727 KM7 S TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0038001003498 KM3 S TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0041001311129 KM6 S TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0059001306427 TM10 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0015001305536 DQ7 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0055001635374 LUPWCHN00001 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0040001165034 KM5 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0027001014707 GS3 S TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0007001118056 Dingo C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0071001336134 YJ2 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0078001336345 YJ9 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0057001567268 LUPWRUS00002 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0063001287691 TM4 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0033001016200 GS9 S TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0005001579767 CHW C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0020001295555 FAMBTIM00001 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0026001001695 GS2 S TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0049001321354 LJ4 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0023001219324 FAMICHN00003 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0021001244739 FAMICHN00001 S TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0068001258002 TM9 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0067001279431 TM8 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0047001265461 LJ2 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0050001214293 LJ5 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0017001318524 DQ9 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0061001325518 TM2 S TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0058001636872 LUPWRUS00003 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0053001274730 LJ8 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0006001514531 CRW C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0016001303876 DQ8 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0008001300840 DQ10 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0034001539168 ISW C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0048001247476 LJ3 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0024001052817 GS10 S TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0031001014385 GS7 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0075001339770 YJ6 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0046001208720 LJ1 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0064001316997 TM5 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
snp_cf0074001324836 YJ5 C TGCACTGCGCCTGTGGATGGATGCCCGCAG GCTGACTTCCCTGAGAACTCTGGGAGTCCC 2014-07-19 2014-07-19
6.Fasta Information
AGGTGTGGGA GAAGTTGCGT TGCACTGCGC CTGTGGATGG ATGCCCGCAG
C
GCTGACTTCC CTGAGAACTC TGGGAGTCCC GCCCTGCAGC TGTGGCCTCC