e.g. 1:1246..9423
SNP Detail For snp_cf0004001435213    [See in GBrowse]
1.General Information
SNP ID: snp_cf0004001435213
Organism: Canis familiaris
Individual: Basenji
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: AAATTCTCCATAGGAATTGACATAGGCCAC
3'flank: GCCTTCTCCCTCAGGGACAGCCTGTAGCCC
3.Reference Map information
Chrom Position Reference Basenji
Chr20 812451 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003884 31709 - A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000006268 633 GCT => GCC ENSCAFP00000005807 211 A => A
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0058002140580 LUPWRUS00003 G AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
snp_cf0074001725786 YJ5 R AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
snp_cf0064001718880 TM5 R AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
snp_cf0034002013182 ISW G AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
snp_cf0048001619252 LJ3 R AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
snp_cf0005002030572 CHW G AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
snp_cf0010001685809 DQ2 R AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
snp_cf0068001666034 TM9 R AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
snp_cf0061001733696 TM2 R AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
snp_cf0050001584441 LJ5 G AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
snp_cf0065001690170 TM6 R AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
snp_cf0070001806993 YJ1 G AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
snp_cf0017001727506 DQ9 R AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
snp_cf0014001679007 DQ6 R AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
snp_cf0056002162406 LUPWRUS00001 G AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
snp_cf0055002135268 LUPWCHN00001 R AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
snp_cf0060001678929 TM1 R AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
snp_cf0021001626301 FAMICHN00001 R AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
snp_cf0045001537963 LJ10 R AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
snp_cf0047001654931 LJ2 R AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
snp_cf0078001746668 YJ9 R AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
snp_cf0066001743717 TM7 G AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
snp_cf0016001711549 DQ8 R AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
snp_cf0067001678648 TM8 R AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
snp_cf0036001342029 KM1 R AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
snp_cf0001000762105 solidGW1 R AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-08-01 2014-08-01
snp_cf0075001748474 YJ6 R AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
snp_cf0049001722541 LJ4 R AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
snp_cf0062001713205 TM3 G AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
snp_cf0057002053027 LUPWRUS00002 G AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
snp_cf0059001701250 TM10 R AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
snp_cf0073001702795 YJ4 R AAATTCTCCATAGGAATTGACATAGGCCAC GCCTTCTCCCTCAGGGACAGCCTGTAGCCC 2014-07-19 2014-07-19
6.Fasta Information
TTTATTTTAT GATGTTCGAC AAATTCTCCA TAGGAATTGA CATAGGCCAC
G
GCCTTCTCCC TCAGGGACAG CCTGTAGCCC CAGTTTAGAG AGCCGATGTG