e.g. 1:1246..9423
SNP Detail For snp_cf0004001435619    [See in GBrowse]
1.General Information
SNP ID: snp_cf0004001435619
Organism: Canis familiaris
Individual: Basenji
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: CCTGGTGGTCCACGAGCAGACCGGCGAGGT
3'flank: TACGTGGGCGCGGTGAACCGCATCTACAAG
3.Reference Map information
Chrom Position Reference Basenji
Chr20 1143353 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003989 213 + A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000006429 213 GTA => GTG ENSCAFP00000005952 71 V => V
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0011001734370 DQ3 G CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0014001679496 DQ6 G CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0073001703264 YJ4 R CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0075001748954 YJ6 G CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0005002031145 CHW G CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0070001807595 YJ1 G CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0061001734171 TM2 G CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0056002163150 LUPWRUS00001 G CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0012001693936 DQ4 G CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0002001125852 CID1 R CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-08-02 2014-08-02
snp_cf0035001657435 KM10 R CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0016001712333 DQ8 R CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0078001747097 YJ9 R CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0064001719328 TM5 R CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0055002135827 LUPWCHN00001 G CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0067001679052 TM8 R CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0021001626742 FAMICHN00001 R CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0057002053575 LUPWRUS00002 G CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0010001686282 DQ2 R CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0017001727965 DQ9 G CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0007001470466 Dingo G CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0052001667817 LJ7 R CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0058002141162 LUPWRUS00003 G CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0049001722976 LJ4 R CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0051001699877 LJ6 R CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0074001726202 YJ5 R CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0076001761697 YJ7 R CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0068001666512 TM9 G CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0036001342447 KM1 R CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0066001744126 TM7 G CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0059001701726 TM10 G CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0001000762421 solidGW1 G CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-08-01 2014-08-01
snp_cf0072001754946 YJ3 R CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0034002013584 ISW G CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0006001977161 CRW G CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0009001710115 DQ1 G CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0062001713623 TM3 G CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0065001690645 TM6 G CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0063001683048 TM4 R CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
snp_cf0060001679709 TM1 R CCTGGTGGTCCACGAGCAGACCGGCGAGGT TACGTGGGCGCGGTGAACCGCATCTACAAG 2014-07-19 2014-07-19
6.Fasta Information
AGTGACTGGG GCCTGACCCA CCTGGTGGTC CACGAGCAGA CCGGCGAGGT
G
TACGTGGGCG CGGTGAACCG CATCTACAAG CTGTCGGGGA ACCTCACGCT