e.g. 1:1246..9423
SNP Detail For snp_cf0004001435636    [See in GBrowse]
1.General Information
SNP ID: snp_cf0004001435636
Organism: Canis familiaris
Individual: Basenji
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: A
5'flank: GGCCTCTCTGCTGCAGCTGTTCCCTGAGAC
3'flank: GGCCCGCGGCAGGGAGGCACGCGGCTCACC
3.Reference Map information
Chrom Position Reference Basenji
Chr20 1166077 G A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003989 22937 + G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000006429 2631 ACG => ACA ENSCAFP00000005952 877 T => T
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0073001703282 YJ4 R GGCCTCTCTGCTGCAGCTGTTCCCTGAGAC GGCCCGCGGCAGGGAGGCACGCGGCTCACC 2014-07-19 2014-07-19
snp_cf0061001734191 TM2 A GGCCTCTCTGCTGCAGCTGTTCCCTGAGAC GGCCCGCGGCAGGGAGGCACGCGGCTCACC 2014-07-19 2014-07-19
snp_cf0012001693955 DQ4 A GGCCTCTCTGCTGCAGCTGTTCCCTGAGAC GGCCCGCGGCAGGGAGGCACGCGGCTCACC 2014-07-19 2014-07-19
snp_cf0059001701742 TM10 A GGCCTCTCTGCTGCAGCTGTTCCCTGAGAC GGCCCGCGGCAGGGAGGCACGCGGCTCACC 2014-07-19 2014-07-19
snp_cf0062001713639 TM3 A GGCCTCTCTGCTGCAGCTGTTCCCTGAGAC GGCCCGCGGCAGGGAGGCACGCGGCTCACC 2014-07-19 2014-07-19
snp_cf0068001666531 TM9 R GGCCTCTCTGCTGCAGCTGTTCCCTGAGAC GGCCCGCGGCAGGGAGGCACGCGGCTCACC 2014-07-19 2014-07-19
snp_cf0075001748980 YJ6 R GGCCTCTCTGCTGCAGCTGTTCCCTGAGAC GGCCCGCGGCAGGGAGGCACGCGGCTCACC 2014-07-19 2014-07-19
snp_cf0007001470481 Dingo A GGCCTCTCTGCTGCAGCTGTTCCCTGAGAC GGCCCGCGGCAGGGAGGCACGCGGCTCACC 2014-07-19 2014-07-19
snp_cf0049001722992 LJ4 R GGCCTCTCTGCTGCAGCTGTTCCCTGAGAC GGCCCGCGGCAGGGAGGCACGCGGCTCACC 2014-07-19 2014-07-19
snp_cf0078001747112 YJ9 R GGCCTCTCTGCTGCAGCTGTTCCCTGAGAC GGCCCGCGGCAGGGAGGCACGCGGCTCACC 2014-07-19 2014-07-19
snp_cf0057002053599 LUPWRUS00002 R GGCCTCTCTGCTGCAGCTGTTCCCTGAGAC GGCCCGCGGCAGGGAGGCACGCGGCTCACC 2014-07-19 2014-07-19
snp_cf0011001734388 DQ3 A GGCCTCTCTGCTGCAGCTGTTCCCTGAGAC GGCCCGCGGCAGGGAGGCACGCGGCTCACC 2014-07-19 2014-07-19
snp_cf0056002163167 LUPWRUS00001 A GGCCTCTCTGCTGCAGCTGTTCCCTGAGAC GGCCCGCGGCAGGGAGGCACGCGGCTCACC 2014-07-19 2014-07-19
snp_cf0076001761712 YJ7 R GGCCTCTCTGCTGCAGCTGTTCCCTGAGAC GGCCCGCGGCAGGGAGGCACGCGGCTCACC 2014-07-19 2014-07-19
snp_cf0021001626760 FAMICHN00001 R GGCCTCTCTGCTGCAGCTGTTCCCTGAGAC GGCCCGCGGCAGGGAGGCACGCGGCTCACC 2014-07-19 2014-07-19
snp_cf0064001719345 TM5 A GGCCTCTCTGCTGCAGCTGTTCCCTGAGAC GGCCCGCGGCAGGGAGGCACGCGGCTCACC 2014-07-19 2014-07-19
snp_cf0052001667830 LJ7 R GGCCTCTCTGCTGCAGCTGTTCCCTGAGAC GGCCCGCGGCAGGGAGGCACGCGGCTCACC 2014-07-19 2014-07-19
snp_cf0005002031175 CHW R GGCCTCTCTGCTGCAGCTGTTCCCTGAGAC GGCCCGCGGCAGGGAGGCACGCGGCTCACC 2014-07-19 2014-07-19
snp_cf0036001342466 KM1 R GGCCTCTCTGCTGCAGCTGTTCCCTGAGAC GGCCCGCGGCAGGGAGGCACGCGGCTCACC 2014-07-19 2014-07-19
snp_cf0063001683065 TM4 A GGCCTCTCTGCTGCAGCTGTTCCCTGAGAC GGCCCGCGGCAGGGAGGCACGCGGCTCACC 2014-07-19 2014-07-19
snp_cf0072001754962 YJ3 R GGCCTCTCTGCTGCAGCTGTTCCCTGAGAC GGCCCGCGGCAGGGAGGCACGCGGCTCACC 2014-07-19 2014-07-19
snp_cf0009001710134 DQ1 A GGCCTCTCTGCTGCAGCTGTTCCCTGAGAC GGCCCGCGGCAGGGAGGCACGCGGCTCACC 2014-07-19 2014-07-19
snp_cf0017001727990 DQ9 R GGCCTCTCTGCTGCAGCTGTTCCCTGAGAC GGCCCGCGGCAGGGAGGCACGCGGCTCACC 2014-07-19 2014-07-19
snp_cf0065001690666 TM6 A GGCCTCTCTGCTGCAGCTGTTCCCTGAGAC GGCCCGCGGCAGGGAGGCACGCGGCTCACC 2014-07-19 2014-07-19
snp_cf0070001807617 YJ1 R GGCCTCTCTGCTGCAGCTGTTCCCTGAGAC GGCCCGCGGCAGGGAGGCACGCGGCTCACC 2014-07-19 2014-07-19
snp_cf0014001679517 DQ6 A GGCCTCTCTGCTGCAGCTGTTCCCTGAGAC GGCCCGCGGCAGGGAGGCACGCGGCTCACC 2014-07-19 2014-07-19
snp_cf0034002013601 ISW A GGCCTCTCTGCTGCAGCTGTTCCCTGAGAC GGCCCGCGGCAGGGAGGCACGCGGCTCACC 2014-07-19 2014-07-19
6.Fasta Information
TGCGCCTGGG TCCCAGCCTC GGCCTCTCTG CTGCAGCTGT TCCCTGAGAC
A
GGCCCGCGGC AGGGAGGCAC GCGGCTCACC ATCACGGGTG AGAACCTGGG