e.g. 1:1246..9423
SNP Detail For snp_cf0004001436330    [See in GBrowse]
1.General Information
SNP ID: snp_cf0004001436330
Organism: Canis familiaris
Individual: Basenji
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: TTTGTCACACAGGTCGGAGCCCTCTGTCTT
3'flank: AGCCTGGACTGCAGCGACGCAATCTCACTG
3.Reference Map information
Chrom Position Reference Basenji
Chr20 2612999 C T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000004148 27700 - C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000006670 1611 CTG => CTA ENSCAFP00000006175 537 L => L
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0006001978462 CRW Y TTTGTCACACAGGTCGGAGCCCTCTGTCTT AGCCTGGACTGCAGCGACGCAATCTCACTG 2014-07-19 2014-07-19
snp_cf0063001683947 TM4 Y TTTGTCACACAGGTCGGAGCCCTCTGTCTT AGCCTGGACTGCAGCGACGCAATCTCACTG 2014-07-19 2014-07-19
snp_cf0001000763222 solidGW1 T TTTGTCACACAGGTCGGAGCCCTCTGTCTT AGCCTGGACTGCAGCGACGCAATCTCACTG 2014-08-01 2014-08-01
snp_cf0055002136991 LUPWCHN00001 Y TTTGTCACACAGGTCGGAGCCCTCTGTCTT AGCCTGGACTGCAGCGACGCAATCTCACTG 2014-07-19 2014-07-19
snp_cf0056002164475 LUPWRUS00001 Y TTTGTCACACAGGTCGGAGCCCTCTGTCTT AGCCTGGACTGCAGCGACGCAATCTCACTG 2014-07-19 2014-07-19
snp_cf0034002014536 ISW T TTTGTCACACAGGTCGGAGCCCTCTGTCTT AGCCTGGACTGCAGCGACGCAATCTCACTG 2014-07-19 2014-07-19
6.Fasta Information
CTGGGATGGC ACACACTTAC TTTGTCACAC AGGTCGGAGC CCTCTGTCTT
T
AGCCTGGACT GCAGCGACGC AATCTCACTG GTCAAGGCCT TGTGTTCTGT