e.g. 1:1246..9423
SNP Detail For snp_cf0004000000007    [See in GBrowse]
1.General Information
SNP ID: snp_cf0004000000007
Organism: Canis familiaris
Individual: Basenji
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: GTCAGTTTTCAAGATAGCCTTAAAGAATAA
3'flank: AGTCTGCAGCATGGAATCCCACTGCACAGC
3.Reference Map information
Chrom Position Reference Basenji
Chr1 34191 G T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0071000000008 YJ2 T GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0013000000006 DQ5 T GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0038000000013 KM3 K GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0009000000012 DQ1 T GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0045000000008 LJ10 K GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0073000000011 YJ4 K GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0032000000010 GS8 K GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0041000000010 KM6 K GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0068000000008 TM9 T GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0061000000010 TM2 K GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0023000000016 FAMICHN00003 K GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0018000000011 FAMBBEM00001 K GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0070000000011 YJ1 T GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0049000000013 LJ4 K GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0040000000013 KM5 K GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0043000000012 KM8 K GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0060000000009 TM1 T GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0014000000011 DQ6 T GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0046000000013 LJ1 K GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0039000000011 KM4 K GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0059000000007 TM10 T GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0044000000006 KM9 K GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0012000000007 DQ4 T GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0053000000008 LJ8 K GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0037000000012 KM2 K GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0062000000005 TM3 T GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0063000000011 TM4 K GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0019000000012 FAMBGSD00001 K GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0025000000011 GS1 K GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0022000000010 FAMICHN00002 K GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0064000000004 TM5 K GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0016000000014 DQ8 T GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0010000000010 DQ2 T GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0074000000010 YJ5 K GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0042000000013 KM7 K GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0067000000007 TM8 T GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0035000000009 KM10 K GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0036000000014 KM1 K GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0017000000010 DQ9 T GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0027000000013 GS3 K GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0078000000009 YJ9 K GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0015000000013 DQ7 K GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0020000000008 FAMBTIM00001 K GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0052000000009 LJ7 T GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
snp_cf0069000000009 YJ10 K GTCAGTTTTCAAGATAGCCTTAAAGAATAA AGTCTGCAGCATGGAATCCCACTGCACAGC 2014-07-19 2014-07-19
6.Fasta Information
AGAGCTTTTC TATGTACAAA GTCAGTTTTC AAGATAGCCT TAAAGAATAA
T
AGTCTGCAGC ATGGAATCCC ACTGCACAGC CACCCAGGAG GCCCGTGCTC