e.g. 1:1246..9423
SNP Detail For snp_cf0004000000009    [See in GBrowse]
1.General Information
SNP ID: snp_cf0004000000009
Organism: Canis familiaris
Individual: Basenji
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: GAATGAGAACAGAGCTCAATGCCCTTGAAG
3'flank: CCCCATACCAAAATGTAAAGAAAACTTGAG
3.Reference Map information
Chrom Position Reference Basenji
Chr1 34601 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0032000000012 GS8 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0038000000015 KM3 R GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0041000000012 KM6 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0023000000018 FAMICHN00003 R GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0035000000011 KM10 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0007000000009 Dingo G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0013000000008 DQ5 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0078000000011 YJ9 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0011000000015 DQ3 R GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0014000000013 DQ6 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0020000000010 FAMBTIM00001 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0044000000008 KM9 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0063000000013 TM4 R GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0069000000011 YJ10 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0002000000056 CID1 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-08-02 2014-08-02
snp_cf0062000000007 TM3 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0059000000009 TM10 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0072000000010 YJ3 R GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0066000000013 TM7 R GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0019000000014 FAMBGSD00001 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0047000000004 LJ2 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0029000000008 GS5 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0064000000006 TM5 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0042000000015 KM7 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0054000000010 LJ9 R GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0048000000014 LJ3 R GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0036000000016 KM1 R GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0060000000011 TM1 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0005000000010 CHW G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0077000000015 YJ8 R GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0017000000012 DQ9 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0065000000013 TM6 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0024000000010 GS10 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0071000000010 YJ2 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0053000000010 LJ8 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0028000000007 GS4 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0006000000013 CRW G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0061000000012 TM2 R GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0076000000013 YJ7 R GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0009000000014 DQ1 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0018000000012 FAMBBEM00001 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0070000000013 YJ1 R GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0049000000015 LJ4 R GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0073000000013 YJ4 R GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0055000000011 LUPWCHN00001 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0058000000017 LUPWRUS00003 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0040000000015 KM5 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0043000000014 KM8 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0012000000009 DQ4 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0037000000014 KM2 R GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0039000000013 KM4 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0052000000011 LJ7 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0046000000015 LJ1 R GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0030000000008 GS6 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0033000000008 GS9 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0031000000011 GS7 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0025000000013 GS1 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0026000000009 GS2 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0057000000013 LUPWRUS00002 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0022000000012 FAMICHN00002 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0016000000016 DQ8 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0045000000010 LJ10 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0074000000012 YJ5 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0010000000012 DQ2 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0050000000019 LJ5 R GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0067000000009 TM8 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0068000000010 TM9 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0027000000015 GS3 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0056000000011 LUPWRUS00001 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0015000000015 DQ7 G GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0034000000020 ISW R GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
snp_cf0021000000014 FAMICHN00001 R GAATGAGAACAGAGCTCAATGCCCTTGAAG CCCCATACCAAAATGTAAAGAAAACTTGAG 2014-07-19 2014-07-19
6.Fasta Information
AGGGCAGGAA GCCCCTATTA GAATGAGAAC AGAGCTCAAT GCCCTTGAAG
G
CCCCATACCA AAATGTAAAG AAAACTTGAG GAATTGCTCC AGCCCTTCTG