e.g. 1:1246..9423
SNP Detail For snp_cf0004000000010    [See in GBrowse]
1.General Information
SNP ID: snp_cf0004000000010
Organism: Canis familiaris
Individual: Basenji
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC
3'flank: ATCCTGGAGACCCGGGATCGAATCCCACAT
3.Reference Map information
Chrom Position Reference Basenji
Chr1 35655 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0032000000013 GS8 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0038000000016 KM3 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0035000000012 KM10 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0041000000013 KM6 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0013000000009 DQ5 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0059000000010 TM10 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0078000000012 YJ9 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0072000000011 YJ3 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0014000000014 DQ6 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0044000000009 KM9 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0007000000010 Dingo G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0020000000011 FAMBTIM00001 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0063000000014 TM4 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0069000000012 YJ10 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0062000000008 TM3 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0011000000016 DQ3 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0066000000014 TM7 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0047000000005 LJ2 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0075000000015 YJ6 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0019000000015 FAMBGSD00001 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0029000000009 GS5 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0077000000016 YJ8 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0064000000007 TM5 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0042000000016 KM7 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0048000000015 LJ3 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0060000000013 TM1 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0005000000011 CHW G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0036000000017 KM1 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0017000000013 DQ9 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0024000000011 GS10 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0065000000014 TM6 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0071000000011 YJ2 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0012000000011 DQ4 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0028000000008 GS4 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0053000000011 LJ8 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0006000000014 CRW G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0067000000010 TM8 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0009000000015 DQ1 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0061000000013 TM2 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0076000000014 YJ7 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0055000000012 LUPWCHN00001 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0018000000013 FAMBBEM00001 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0070000000014 YJ1 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0049000000016 LJ4 R TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0073000000014 YJ4 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0058000000018 LUPWRUS00003 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0040000000017 KM5 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0037000000015 KM2 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0052000000012 LJ7 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0031000000012 GS7 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0030000000009 GS6 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0025000000014 GS1 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0033000000009 GS9 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0043000000015 KM8 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0016000000017 DQ8 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0057000000014 LUPWRUS00002 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0074000000013 YJ5 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0022000000013 FAMICHN00002 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0039000000014 KM4 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0045000000011 LJ10 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0023000000020 FAMICHN00003 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0010000000013 DQ2 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0051000000014 LJ6 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0001000000041 solidGW1 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-08-01 2014-08-01
snp_cf0068000000011 TM9 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0021000000015 FAMICHN00001 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0027000000016 GS3 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0008000000008 DQ10 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0056000000012 LUPWRUS00001 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0026000000010 GS2 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0034000000021 ISW G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
snp_cf0015000000016 DQ7 G TGTTTGGCGCCTGTCCTTGGCCCAGGGTGC ATCCTGGAGACCCGGGATCGAATCCCACAT 2014-07-19 2014-07-19
6.Fasta Information
GGATCCCTGG GTGGCACAGC TGTTTGGCGC CTGTCCTTGG CCCAGGGTGC
G
ATCCTGGAGA CCCGGGATCG AATCCCACAT CGGGCTTCCG GTGCATGGAG