e.g. 1:1246..9423
SNP Detail For snp_cf0004003240596    [See in GBrowse]
1.General Information
SNP ID: snp_cf0004003240596
Organism: Canis familiaris
Individual: Basenji
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG
3'flank: GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG
3.Reference Map information
Chrom Position Reference Basenji
Chr5 932411 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000031837 1168 - A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000048530 1168 TCA => CCA ENSCAFP00000041261 390 S => P
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0063003810598 TM4 R GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0075003968981 YJ6 R GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0067003822354 TM8 G GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0078003952916 YJ9 G GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0057004584937 LUPWRUS00002 R GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0065003863712 TM6 G GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0071003965211 YJ2 G GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0015003869049 DQ7 G GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0018003224448 FAMBBEM00001 G GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0014003830113 DQ6 G GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0062003878882 TM3 G GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0025003021860 GS1 R GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0051003873149 LJ6 R GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0019003007068 FAMBGSD00001 R GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0035003758849 KM10 R GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0036003083494 KM1 R GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0072003980995 YJ3 R GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0044003416069 KM9 R GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0007003282195 Dingo G GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0052003813543 LJ7 R GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0042004033421 KM7 G GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0076003991631 YJ7 G GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0056004808096 LUPWRUS00001 R GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0060003786812 TM1 G GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0053003790704 LJ8 G GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0039003270364 KM4 G GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0013003811004 DQ5 R GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0024003045834 GS10 R GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0066003973199 TM7 R GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0068003831774 TM9 G GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0041003863173 KM6 G GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0059003876969 TM10 G GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0037003232610 KM2 G GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0070004105797 YJ1 R GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0061003929262 TM2 G GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0020003845701 FAMBTIM00001 G GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0043003269857 KM8 R GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0012003872819 DQ4 G GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0074003897351 YJ5 G GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0069003995917 YJ10 G GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0011003931267 DQ3 R GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0016003881022 DQ8 G GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0021003716410 FAMICHN00001 R GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0008003931171 DQ10 R GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0038003130932 KM3 G GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0064003907822 TM5 G GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0009003867057 DQ1 R GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0073003884326 YJ4 G GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
snp_cf0040003371960 KM5 R GTGAGCTTCCGCTTTCCCGCCGGCGTCCTG GCCTTCCCCCGGGTGGAGGTGGGCGCAGAG 2014-07-19 2014-07-19
6.Fasta Information
CAAACACCTG TGCGGCCTCC GTGAGCTTCC GCTTTCCCGC CGGCGTCCTG
G
GCCTTCCCCC GGGTGGAGGT GGGCGCAGAG GTTGGAACCG CAGTCAGGGA