e.g. 1:1246..9423
SNP Detail For snp_cf0004003240597    [See in GBrowse]
1.General Information
SNP ID: snp_cf0004003240597
Organism: Canis familiaris
Individual: Basenji
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT
3'flank: GGCGCAGAGGTTGGAACCGCAGTCAGGGAA
3.Reference Map information
Chrom Position Reference Basenji
Chr5 932432 G T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000031837 1147 - G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000048530 1147 CAC => AAC ENSCAFP00000041261 383 H => N
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0063003810599 TM4 K GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0076003991632 YJ7 T GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0051003873150 LJ6 K GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0078003952917 YJ9 T GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0053003790705 LJ8 T GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0065003863713 TM6 T GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0013003811005 DQ5 K GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0024003045835 GS10 K GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0056004808097 LUPWRUS00001 K GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0039003270365 KM4 T GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0059003876970 TM10 T GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0041003863174 KM6 K GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0071003965212 YJ2 K GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0062003878883 TM3 K GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0023003702975 FAMICHN00003 T GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0068003831775 TM9 T GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0012003872820 DQ4 T GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0018003224449 FAMBBEM00001 T GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0014003830114 DQ6 T GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0070004105798 YJ1 K GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0037003232611 KM2 T GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0061003929263 TM2 T GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0025003021861 GS1 K GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0074003897352 YJ5 T GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0020003845702 FAMBTIM00001 T GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0019003007069 FAMBGSD00001 K GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0011003931268 DQ3 K GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0066003973200 TM7 K GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0016003881023 DQ8 T GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0021003716411 FAMICHN00001 K GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0007003282196 Dingo K GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0008003931172 DQ10 K GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0036003083495 KM1 K GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0064003907823 TM5 T GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0067003822355 TM8 T GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0009003867058 DQ1 K GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0042004033422 KM7 K GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0052003813544 LJ7 K GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0073003884327 YJ4 T GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0038003130933 KM3 K GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
snp_cf0040003371961 KM5 K GGCGTCCTGAGCCTTCCCCCGGGTGGAGGT GGCGCAGAGGTTGGAACCGCAGTCAGGGAA 2014-07-19 2014-07-19
6.Fasta Information
TGAGCTTCCG CTTTCCCGCC GGCGTCCTGA GCCTTCCCCC GGGTGGAGGT
T
GGCGCAGAGG TTGGAACCGC AGTCAGGGAA ACCGATGCAG ACGCAATGGG