e.g. 1:1246..9423
SNP Detail For snp_cf0004003240824    [See in GBrowse]
1.General Information
SNP ID: snp_cf0004003240824
Organism: Canis familiaris
Individual: Basenji
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: CAGCCCTCCACTGAACCCAAGGCAATTGCC
3'flank: GCCAAGCACCGCCTCTGTCTCCTGCCCCAG
3.Reference Map information
Chrom Position Reference Basenji
Chr5 1075850 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000009799 55091 + A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000015562 3919 AGC => GGC ENSCAFP00000014400 1307 S => G
+ ENSCAFT00000048354 3973 AGC => GGC ENSCAFP00000041968 1325 S => G
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0001001682356 solidGW1 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-08-01 2014-08-01
snp_cf0025003022109 GS1 R CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0069003996214 YJ10 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0011003931537 DQ3 R CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0074003897606 YJ5 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0065003863951 TM6 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0016003881259 DQ8 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0014003830361 DQ6 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0051003873410 LJ6 R CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0047003776508 LJ2 R CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0018003224687 FAMBBEM00001 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0013003811273 DQ5 R CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0019003007307 FAMBGSD00001 R CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0005004629373 CHW R CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0061003929501 TM2 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0070004106065 YJ1 R CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0072003981271 YJ3 R CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0064003908069 TM5 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0063003810862 TM4 R CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0020003845964 FAMBTIM00001 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0036003083735 KM1 R CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0023003703220 FAMICHN00003 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0021003716673 FAMICHN00001 R CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0073003884580 YJ4 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0006004449258 CRW G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0038003131200 KM3 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0015003869296 DQ7 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0043003270102 KM8 R CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0055004778444 LUPWCHN00001 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0037003232860 KM2 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0041003863448 KM6 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0066003973474 TM7 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0059003877222 TM10 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0071003965475 YJ2 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0053003790940 LJ8 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0067003822607 TM8 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0044003416316 KM9 R CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0009003867324 DQ1 R CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0078003953155 YJ9 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0022003464421 FAMICHN00002 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0040003372205 KM5 R CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0007003282446 Dingo G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0042004033698 KM7 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0048003692657 LJ3 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0076003991888 YJ7 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0075003969267 YJ6 R CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0056004808328 LUPWRUS00001 R CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0058004773284 LUPWRUS00003 R CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0034004477422 ISW G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0062003879149 TM3 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0068003832017 TM9 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0008003931415 DQ10 R CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0052003813808 LJ7 R CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0012003873068 DQ4 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0024003046081 GS10 R CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0057004585219 LUPWRUS00002 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0039003270618 KM4 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
snp_cf0060003787056 TM1 G CAGCCCTCCACTGAACCCAAGGCAATTGCC GCCAAGCACCGCCTCTGTCTCCTGCCCCAG 2014-07-19 2014-07-19
6.Fasta Information
CTGTACCTGC TGTTGCGAGC CAGCCCTCCA CTGAACCCAA GGCAATTGCC
G
GCCAAGCACC GCCTCTGTCT CCTGCCCCAG AGACGGGGCT GTTGAAGAGG