e.g. 1:1246..9423
SNP Detail For snp_cf0004003241103    [See in GBrowse]
1.General Information
SNP ID: snp_cf0004003241103
Organism: Canis familiaris
Individual: Basenji
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: AGAGACAGACAGAATGACAGGCTCCTGCGA
3'flank: CAGCCCGCCCGAGAGAGCCCACTCTAAACT
3.Reference Map information
Chrom Position Reference Basenji
Chr5 1309964 A T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000009823 36101 + A CDS
ENSCAFG00000009823 36101 + A intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000015597 4013 AAC => ATC ENSCAFP00000014433 1338 N => I
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0049003903526 LJ4 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0052003814173 LJ7 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0055004779011 LUPWCHN00001 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0020003846269 FAMBTIM00001 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0051003873612 LJ6 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0063003811206 TM4 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0023003703530 FAMICHN00003 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0046003614245 LJ1 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0019003007596 FAMBGSD00001 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0048003692911 LJ3 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0039003270946 KM4 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0041003863797 KM6 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0024003046392 GS10 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0060003787362 TM1 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0074003897931 YJ5 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0047003776775 LJ2 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0027003037064 GS3 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0014003830722 DQ6 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0035003759219 KM10 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0026003045467 GS2 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0066003973790 TM7 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0062003879488 TM3 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0006004449535 CRW T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0005004629682 CHW T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0045003540850 LJ10 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0044003416629 KM9 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0038003131529 KM3 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0067003822911 TM8 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0043003270416 KM8 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0040003372520 KM5 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0025003022406 GS1 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0050003603019 LJ5 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0073003884939 YJ4 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0076003992245 YJ7 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0065003864224 TM6 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0028002942343 GS4 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0070004106328 YJ1 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0072003981658 YJ3 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0021003716911 FAMICHN00001 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0064003908390 TM5 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0013003811645 DQ5 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0029002863724 GS5 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0016003881432 DQ8 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0008003931719 DQ10 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0069003996715 YJ10 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0015003869621 DQ7 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0036003084033 KM1 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0061003929809 TM2 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0075003969602 YJ6 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0031003071093 GS7 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0033003051318 GS9 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0012003873432 DQ4 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0032002985052 GS8 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0011003931906 DQ3 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0017003925689 DQ9 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0056004808520 LUPWRUS00001 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0077003946097 YJ8 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0078003953335 YJ9 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0010003892863 DQ2 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0053003791104 LJ8 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0068003832336 TM9 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0058004773558 LUPWRUS00003 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0059003877546 TM10 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0030003028706 GS6 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0057004585572 LUPWRUS00002 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0018003224938 FAMBBEM00001 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0071003965825 YJ2 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0042004034058 KM7 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
snp_cf0037003233213 KM2 T AGAGACAGACAGAATGACAGGCTCCTGCGA CAGCCCGCCCGAGAGAGCCCACTCTAAACT 2014-07-19 2014-07-19
6.Fasta Information
TCGCAGGAAG CTGCAGACAG AGAGACAGAC AGAATGACAG GCTCCTGCGA
T
CAGCCCGCCC GAGAGAGCCC ACTCTAAACT GTAGCAGGTG GAATTCCAGG