e.g. 1:1246..9423
SNP Detail For snp_cf0040000000007    [See in GBrowse]
1.General Information
SNP ID: snp_cf0040000000007
Organism: Canis familiaris
Individual: KM5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: M
5'flank: CCAGGCACACAAGACTAGTGCCTCCAAGCT
3'flank: AATCCAGCAATTTCCTAGTAATTCATGTGG
3.Reference Map information
Chrom Position Reference KM5
Chr1 30006 C M
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0019000000005 FAMBGSD00001 M CCAGGCACACAAGACTAGTGCCTCCAAGCT AATCCAGCAATTTCCTAGTAATTCATGTGG 2014-07-19 2014-07-19
snp_cf0027000000007 GS3 M CCAGGCACACAAGACTAGTGCCTCCAAGCT AATCCAGCAATTTCCTAGTAATTCATGTGG 2014-07-19 2014-07-19
snp_cf0036000000005 KM1 M CCAGGCACACAAGACTAGTGCCTCCAAGCT AATCCAGCAATTTCCTAGTAATTCATGTGG 2014-07-19 2014-07-19
snp_cf0025000000005 GS1 M CCAGGCACACAAGACTAGTGCCTCCAAGCT AATCCAGCAATTTCCTAGTAATTCATGTGG 2014-07-19 2014-07-19
snp_cf0078000000006 YJ9 A CCAGGCACACAAGACTAGTGCCTCCAAGCT AATCCAGCAATTTCCTAGTAATTCATGTGG 2014-07-19 2014-07-19
snp_cf0043000000005 KM8 M CCAGGCACACAAGACTAGTGCCTCCAAGCT AATCCAGCAATTTCCTAGTAATTCATGTGG 2014-07-19 2014-07-19
snp_cf0032000000004 GS8 M CCAGGCACACAAGACTAGTGCCTCCAAGCT AATCCAGCAATTTCCTAGTAATTCATGTGG 2014-07-19 2014-07-19
6.Fasta Information
GGGAGAGGTA ATTGGAGTCT CCAGGCACAC AAGACTAGTG CCTCCAAGCT
M
AATCCAGCAA TTTCCTAGTA ATTCATGTGG TAGACTGGTG CTACATACTA