e.g. 1:1246..9423
SNP Detail For snp_cf0040000000009    [See in GBrowse]
1.General Information
SNP ID: snp_cf0040000000009
Organism: Canis familiaris
Individual: KM5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: TGTATCTGAGATGAATACACTGTTTTCCAA
3'flank: GGTCTTCTTCAATCAGAGTGTAGCTAGGTT
3.Reference Map information
Chrom Position Reference KM5
Chr1 30515 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0042000000009 KM7 Y TGTATCTGAGATGAATACACTGTTTTCCAA GGTCTTCTTCAATCAGAGTGTAGCTAGGTT 2014-07-19 2014-07-19
snp_cf0019000000007 FAMBGSD00001 Y TGTATCTGAGATGAATACACTGTTTTCCAA GGTCTTCTTCAATCAGAGTGTAGCTAGGTT 2014-07-19 2014-07-19
snp_cf0006000000010 CRW T TGTATCTGAGATGAATACACTGTTTTCCAA GGTCTTCTTCAATCAGAGTGTAGCTAGGTT 2014-07-19 2014-07-19
snp_cf0029000000005 GS5 T TGTATCTGAGATGAATACACTGTTTTCCAA GGTCTTCTTCAATCAGAGTGTAGCTAGGTT 2014-07-19 2014-07-19
snp_cf0057000000009 LUPWRUS00002 T TGTATCTGAGATGAATACACTGTTTTCCAA GGTCTTCTTCAATCAGAGTGTAGCTAGGTT 2014-07-19 2014-07-19
snp_cf0058000000013 LUPWRUS00003 Y TGTATCTGAGATGAATACACTGTTTTCCAA GGTCTTCTTCAATCAGAGTGTAGCTAGGTT 2014-07-19 2014-07-19
snp_cf0032000000006 GS8 Y TGTATCTGAGATGAATACACTGTTTTCCAA GGTCTTCTTCAATCAGAGTGTAGCTAGGTT 2014-07-19 2014-07-19
snp_cf0026000000006 GS2 T TGTATCTGAGATGAATACACTGTTTTCCAA GGTCTTCTTCAATCAGAGTGTAGCTAGGTT 2014-07-19 2014-07-19
snp_cf0070000000010 YJ1 Y TGTATCTGAGATGAATACACTGTTTTCCAA GGTCTTCTTCAATCAGAGTGTAGCTAGGTT 2014-07-19 2014-07-19
snp_cf0041000000006 KM6 Y TGTATCTGAGATGAATACACTGTTTTCCAA GGTCTTCTTCAATCAGAGTGTAGCTAGGTT 2014-07-19 2014-07-19
snp_cf0031000000008 GS7 T TGTATCTGAGATGAATACACTGTTTTCCAA GGTCTTCTTCAATCAGAGTGTAGCTAGGTT 2014-07-19 2014-07-19
snp_cf0050000000014 LJ5 Y TGTATCTGAGATGAATACACTGTTTTCCAA GGTCTTCTTCAATCAGAGTGTAGCTAGGTT 2014-07-19 2014-07-19
snp_cf0027000000009 GS3 Y TGTATCTGAGATGAATACACTGTTTTCCAA GGTCTTCTTCAATCAGAGTGTAGCTAGGTT 2014-07-19 2014-07-19
snp_cf0033000000004 GS9 Y TGTATCTGAGATGAATACACTGTTTTCCAA GGTCTTCTTCAATCAGAGTGTAGCTAGGTT 2014-07-19 2014-07-19
snp_cf0025000000007 GS1 Y TGTATCTGAGATGAATACACTGTTTTCCAA GGTCTTCTTCAATCAGAGTGTAGCTAGGTT 2014-07-19 2014-07-19
snp_cf0021000000010 FAMICHN00001 Y TGTATCTGAGATGAATACACTGTTTTCCAA GGTCTTCTTCAATCAGAGTGTAGCTAGGTT 2014-07-19 2014-07-19
snp_cf0028000000004 GS4 T TGTATCTGAGATGAATACACTGTTTTCCAA GGTCTTCTTCAATCAGAGTGTAGCTAGGTT 2014-07-19 2014-07-19
snp_cf0048000000010 LJ3 Y TGTATCTGAGATGAATACACTGTTTTCCAA GGTCTTCTTCAATCAGAGTGTAGCTAGGTT 2014-07-19 2014-07-19
snp_cf0024000000007 GS10 T TGTATCTGAGATGAATACACTGTTTTCCAA GGTCTTCTTCAATCAGAGTGTAGCTAGGTT 2014-07-19 2014-07-19
snp_cf0030000000004 GS6 Y TGTATCTGAGATGAATACACTGTTTTCCAA GGTCTTCTTCAATCAGAGTGTAGCTAGGTT 2014-07-19 2014-07-19
6.Fasta Information
CTATTGAGCC TGAACTCACG TGTATCTGAG ATGAATACAC TGTTTTCCAA
Y
GGTCTTCTTC AATCAGAGTG TAGCTAGGTT CCTACTCCCA TGTACTAGTG