e.g. 1:1246..9423
SNP Detail For snp_cf0040000000010    [See in GBrowse]
1.General Information
SNP ID: snp_cf0040000000010
Organism: Canis familiaris
Individual: KM5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: K
5'flank: GTATACACAATTCTGAGAGTTTAGCTTATG
3'flank: CCTGTAACCCTACATCGTGCCTGCAGGTAC
3.Reference Map information
Chrom Position Reference KM5
Chr1 32085 G K
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0057000000010 LUPWRUS00002 T GTATACACAATTCTGAGAGTTTAGCTTATG CCTGTAACCCTACATCGTGCCTGCAGGTAC 2014-07-19 2014-07-19
snp_cf0019000000008 FAMBGSD00001 K GTATACACAATTCTGAGAGTTTAGCTTATG CCTGTAACCCTACATCGTGCCTGCAGGTAC 2014-07-19 2014-07-19
snp_cf0029000000006 GS5 T GTATACACAATTCTGAGAGTTTAGCTTATG CCTGTAACCCTACATCGTGCCTGCAGGTAC 2014-07-19 2014-07-19
snp_cf0042000000010 KM7 K GTATACACAATTCTGAGAGTTTAGCTTATG CCTGTAACCCTACATCGTGCCTGCAGGTAC 2014-07-19 2014-07-19
snp_cf0032000000007 GS8 K GTATACACAATTCTGAGAGTTTAGCTTATG CCTGTAACCCTACATCGTGCCTGCAGGTAC 2014-07-19 2014-07-19
snp_cf0041000000007 KM6 K GTATACACAATTCTGAGAGTTTAGCTTATG CCTGTAACCCTACATCGTGCCTGCAGGTAC 2014-07-19 2014-07-19
snp_cf0026000000007 GS2 T GTATACACAATTCTGAGAGTTTAGCTTATG CCTGTAACCCTACATCGTGCCTGCAGGTAC 2014-07-19 2014-07-19
snp_cf0027000000010 GS3 K GTATACACAATTCTGAGAGTTTAGCTTATG CCTGTAACCCTACATCGTGCCTGCAGGTAC 2014-07-19 2014-07-19
snp_cf0031000000009 GS7 T GTATACACAATTCTGAGAGTTTAGCTTATG CCTGTAACCCTACATCGTGCCTGCAGGTAC 2014-07-19 2014-07-19
snp_cf0050000000015 LJ5 K GTATACACAATTCTGAGAGTTTAGCTTATG CCTGTAACCCTACATCGTGCCTGCAGGTAC 2014-07-19 2014-07-19
snp_cf0025000000008 GS1 K GTATACACAATTCTGAGAGTTTAGCTTATG CCTGTAACCCTACATCGTGCCTGCAGGTAC 2014-07-19 2014-07-19
snp_cf0033000000005 GS9 K GTATACACAATTCTGAGAGTTTAGCTTATG CCTGTAACCCTACATCGTGCCTGCAGGTAC 2014-07-19 2014-07-19
snp_cf0028000000005 GS4 T GTATACACAATTCTGAGAGTTTAGCTTATG CCTGTAACCCTACATCGTGCCTGCAGGTAC 2014-07-19 2014-07-19
snp_cf0024000000008 GS10 T GTATACACAATTCTGAGAGTTTAGCTTATG CCTGTAACCCTACATCGTGCCTGCAGGTAC 2014-07-19 2014-07-19
snp_cf0030000000005 GS6 K GTATACACAATTCTGAGAGTTTAGCTTATG CCTGTAACCCTACATCGTGCCTGCAGGTAC 2014-07-19 2014-07-19
6.Fasta Information
AGCAGATCTT TGCCTCCCAT GTATACACAA TTCTGAGAGT TTAGCTTATG
K
CCTGTAACCC TACATCGTGC CTGCAGGTAC CTTTCGCTTC CAAAAGGTCT