e.g. 1:1246..9423
SNP Detail For snp_cf0040001369943    [See in GBrowse]
1.General Information
SNP ID: snp_cf0040001369943
Organism: Canis familiaris
Individual: KM5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: S
5'flank: GGACCCCTTTGAAATCCACGCTGTCACCCC
3'flank: CTCCTCGGGGAGGGAACCCGAGGCCGTCCC
3.Reference Map information
Chrom Position Reference KM5
Chr2 1317856 G S
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000029576 2048 - G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000044664 2048 GCG => GGG ENSCAFP00000035908 683 A => G
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0012001541664 DQ4 S GGACCCCTTTGAAATCCACGCTGTCACCCC CTCCTCGGGGAGGGAACCCGAGGCCGTCCC 2014-07-19 2014-07-19
snp_cf0036001208813 KM1 C GGACCCCTTTGAAATCCACGCTGTCACCCC CTCCTCGGGGAGGGAACCCGAGGCCGTCCC 2014-07-19 2014-07-19
snp_cf0049001554944 LJ4 C GGACCCCTTTGAAATCCACGCTGTCACCCC CTCCTCGGGGAGGGAACCCGAGGCCGTCCC 2014-07-19 2014-07-19
snp_cf0068001498548 TM9 S GGACCCCTTTGAAATCCACGCTGTCACCCC CTCCTCGGGGAGGGAACCCGAGGCCGTCCC 2014-07-19 2014-07-19
snp_cf0018001302140 FAMBBEM00001 C GGACCCCTTTGAAATCCACGCTGTCACCCC CTCCTCGGGGAGGGAACCCGAGGCCGTCCC 2014-07-19 2014-07-19
snp_cf0039001269494 KM4 S GGACCCCTTTGAAATCCACGCTGTCACCCC CTCCTCGGGGAGGGAACCCGAGGCCGTCCC 2014-07-19 2014-07-19
snp_cf0016001544904 DQ8 S GGACCCCTTTGAAATCCACGCTGTCACCCC CTCCTCGGGGAGGGAACCCGAGGCCGTCCC 2014-07-19 2014-07-19
snp_cf0025001186671 GS1 S GGACCCCTTTGAAATCCACGCTGTCACCCC CTCCTCGGGGAGGGAACCCGAGGCCGTCCC 2014-07-19 2014-07-19
snp_cf0059001535720 TM10 S GGACCCCTTTGAAATCCACGCTGTCACCCC CTCCTCGGGGAGGGAACCCGAGGCCGTCCC 2014-07-19 2014-07-19
snp_cf0060001526673 TM1 S GGACCCCTTTGAAATCCACGCTGTCACCCC CTCCTCGGGGAGGGAACCCGAGGCCGTCCC 2014-07-19 2014-07-19
snp_cf0010001528116 DQ2 S GGACCCCTTTGAAATCCACGCTGTCACCCC CTCCTCGGGGAGGGAACCCGAGGCCGTCCC 2014-07-19 2014-07-19
snp_cf0067001518315 TM8 C GGACCCCTTTGAAATCCACGCTGTCACCCC CTCCTCGGGGAGGGAACCCGAGGCCGTCCC 2014-07-19 2014-07-19
snp_cf0015001544563 DQ7 S GGACCCCTTTGAAATCCACGCTGTCACCCC CTCCTCGGGGAGGGAACCCGAGGCCGTCCC 2014-07-19 2014-07-19
snp_cf0047001499856 LJ2 S GGACCCCTTTGAAATCCACGCTGTCACCCC CTCCTCGGGGAGGGAACCCGAGGCCGTCCC 2014-07-19 2014-07-19
snp_cf0030001200121 GS6 S GGACCCCTTTGAAATCCACGCTGTCACCCC CTCCTCGGGGAGGGAACCCGAGGCCGTCCC 2014-07-19 2014-07-19
snp_cf0026001181729 GS2 S GGACCCCTTTGAAATCCACGCTGTCACCCC CTCCTCGGGGAGGGAACCCGAGGCCGTCCC 2014-07-19 2014-07-19
snp_cf0034001821638 ISW C GGACCCCTTTGAAATCCACGCTGTCACCCC CTCCTCGGGGAGGGAACCCGAGGCCGTCCC 2014-07-19 2014-07-19
snp_cf0066001576324 TM7 S GGACCCCTTTGAAATCCACGCTGTCACCCC CTCCTCGGGGAGGGAACCCGAGGCCGTCCC 2014-07-19 2014-07-19
snp_cf0019001184175 FAMBGSD00001 C GGACCCCTTTGAAATCCACGCTGTCACCCC CTCCTCGGGGAGGGAACCCGAGGCCGTCCC 2014-07-19 2014-07-19
snp_cf0027001205064 GS3 S GGACCCCTTTGAAATCCACGCTGTCACCCC CTCCTCGGGGAGGGAACCCGAGGCCGTCCC 2014-07-19 2014-07-19
snp_cf0035001496835 KM10 S GGACCCCTTTGAAATCCACGCTGTCACCCC CTCCTCGGGGAGGGAACCCGAGGCCGTCCC 2014-07-19 2014-07-19
snp_cf0031001205424 GS7 S GGACCCCTTTGAAATCCACGCTGTCACCCC CTCCTCGGGGAGGGAACCCGAGGCCGTCCC 2014-07-19 2014-07-19
snp_cf0028001145978 GS4 C GGACCCCTTTGAAATCCACGCTGTCACCCC CTCCTCGGGGAGGGAACCCGAGGCCGTCCC 2014-07-19 2014-07-19
snp_cf0009001543446 DQ1 C GGACCCCTTTGAAATCCACGCTGTCACCCC CTCCTCGGGGAGGGAACCCGAGGCCGTCCC 2014-07-19 2014-07-19
snp_cf0017001557134 DQ9 S GGACCCCTTTGAAATCCACGCTGTCACCCC CTCCTCGGGGAGGGAACCCGAGGCCGTCCC 2014-07-19 2014-07-19
snp_cf0013001468514 DQ5 S GGACCCCTTTGAAATCCACGCTGTCACCCC CTCCTCGGGGAGGGAACCCGAGGCCGTCCC 2014-07-19 2014-07-19
snp_cf0033001209285 GS9 S GGACCCCTTTGAAATCCACGCTGTCACCCC CTCCTCGGGGAGGGAACCCGAGGCCGTCCC 2014-07-19 2014-07-19
snp_cf0029001127515 GS5 S GGACCCCTTTGAAATCCACGCTGTCACCCC CTCCTCGGGGAGGGAACCCGAGGCCGTCCC 2014-07-19 2014-07-19
6.Fasta Information
TTTTATCCCA CCTGACTACG GGACCCCTTT GAAATCCACG CTGTCACCCC
S
CTCCTCGGGG AGGGAACCCG AGGCCGTCCC GGCCGCTCGG CGGAGGCGGG