e.g. 1:1246..9423
SNP Detail For snp_cf0040001369945    [See in GBrowse]
1.General Information
SNP ID: snp_cf0040001369945
Organism: Canis familiaris
Individual: KM5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: GGGGCTGCGCGGTCCGGGGGCGAGCATGAG
3'flank: CCCCGGGGCCCGAGGGGGGGCCGCCGGGGC
3.Reference Map information
Chrom Position Reference KM5
Chr2 1318784 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000029576 1120 - C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000044664 1120 GCT => GCT,ACT ENSCAFP00000035908 374 A => A,T
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0031001205426 GS7 Y GGGGCTGCGCGGTCCGGGGGCGAGCATGAG CCCCGGGGCCCGAGGGGGGGCCGCCGGGGC 2014-07-19 2014-07-19
snp_cf0032001189236 GS8 T GGGGCTGCGCGGTCCGGGGGCGAGCATGAG CCCCGGGGCCCGAGGGGGGGCCGCCGGGGC 2014-07-19 2014-07-19
6.Fasta Information
AGGTCTCGAG CTCCCGCGGC GGGGCTGCGC GGTCCGGGGG CGAGCATGAG
Y
CCCCGGGGCC CGAGGGGGGG CCGCCGGGGC TGAGCGGCGG GAGCGGCCTG