e.g. 1:1246..9423
SNP Detail For snp_cf0040001370474    [See in GBrowse]
1.General Information
SNP ID: snp_cf0040001370474
Organism: Canis familiaris
Individual: KM5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: ATGTGCTCTGTTCTGGTATTATAGGATGAA
3'flank: AAGTCTCAGTTTCAAATTGTAATCCTCTCC
3.Reference Map information
Chrom Position Reference KM5
Chr2 1852396 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000029571 175 - G CDS
ENSCAFG00000003705 22726 + G intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000043361 175 CTT => TTT ENSCAFP00000037764 59 L => F
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0020001534812 FAMBTIM00001 R ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
snp_cf0027001205603 GS3 R ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
snp_cf0028001146462 GS4 A ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
snp_cf0016001545519 DQ8 R ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
snp_cf0015001545190 DQ7 R ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
snp_cf0054001383712 LJ9 R ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
snp_cf0004001298605 Basenji A ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
snp_cf0060001527303 TM1 R ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
snp_cf0031001205913 GS7 A ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
snp_cf0018001302719 FAMBBEM00001 R ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
snp_cf0009001543932 DQ1 A ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
snp_cf0032001189711 GS8 A ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
snp_cf0023001443276 FAMICHN00003 R ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
snp_cf0062001558927 TM3 R ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
snp_cf0078001578925 YJ9 R ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
snp_cf0006001796187 CRW R ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
snp_cf0046001438166 LJ1 R ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
snp_cf0019001184649 FAMBGSD00001 A ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
snp_cf0033001209898 GS9 R ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
snp_cf0030001200745 GS6 R ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
snp_cf0025001187215 GS1 R ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
snp_cf0061001570617 TM2 R ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
snp_cf0012001542309 DQ4 R ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
snp_cf0063001527065 TM4 R ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
snp_cf0008001537826 DQ10 R ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
snp_cf0026001182276 GS2 R ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
snp_cf0035001497505 KM10 R ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
snp_cf0036001209288 KM1 A ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
snp_cf0029001128124 GS5 R ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
snp_cf0039001270185 KM4 R ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
snp_cf0049001555572 LJ4 R ATGTGCTCTGTTCTGGTATTATAGGATGAA AAGTCTCAGTTTCAAATTGTAATCCTCTCC 2014-07-19 2014-07-19
6.Fasta Information
CTTTGTCGAA AGTACTTTAA ATGTGCTCTG TTCTGGTATT ATAGGATGAA
R
AAGTCTCAGT TTCAAATTGT AATCCTCTCC AGAAGGAAGT TTCACCAAAG