e.g. 1:1246..9423
SNP Detail For snp_cf0040001372640    [See in GBrowse]
1.General Information
SNP ID: snp_cf0040001372640
Organism: Canis familiaris
Individual: KM5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: GGGTTGATGATATGTTGATAATGATTTCTG
3'flank: CTGGCAGAAGACCAGCGCCAAGGACAGCAT
3.Reference Map information
Chrom Position Reference KM5
Chr2 6174554 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000013789 14452 + C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000021893 1058 GCC => GTC ENSCAFP00000020336 353 A => V
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0037001295358 KM2 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0018001305218 FAMBBEM00001 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0065001527479 TM6 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0071001582703 YJ2 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0045001400029 LJ10 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0046001439765 LJ1 T GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0011001570690 DQ3 T GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0012001545267 DQ4 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0025001189503 GS1 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0028001149311 GS4 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0060001530515 TM1 T GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0052001513730 LJ7 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0041001560421 KM6 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0019001187445 FAMBGSD00001 T GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0013001472315 DQ5 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0075001586137 YJ6 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0077001570830 YJ8 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0069001600827 YJ10 T GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0031001208768 GS7 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0076001598813 YJ7 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0033001212716 GS9 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0026001184822 GS2 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0074001567925 YJ5 T GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0010001531262 DQ2 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0070001638076 YJ1 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0062001562307 TM3 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0051001542171 LJ6 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0004001301101 Basenji T GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0061001573029 TM2 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0009001547168 DQ1 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0035001500549 KM10 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0016001548486 DQ8 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0073001536613 YJ4 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0024001237844 GS10 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0032001191718 GS8 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0015001547642 DQ7 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0043001304415 KM8 T GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0007001331568 Dingo T GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0027001208119 GS3 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
snp_cf0047001503581 LJ2 Y GGGTTGATGATATGTTGATAATGATTTCTG CTGGCAGAAGACCAGCGCCAAGGACAGCAT 2014-07-19 2014-07-19
6.Fasta Information
TGTTGTTTTA ACAGGTGTTG GGGTTGATGA TATGTTGATA ATGATTTCTG
Y
CTGGCAGAAG ACCAGCGCCA AGGACAGCAT GAGCCAGAGG CTTTCCACCG