e.g. 1:1246..9423
SNP Detail For snp_cf0040003372045    [See in GBrowse]
1.General Information
SNP ID: snp_cf0040003372045
Organism: Canis familiaris
Individual: KM5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: GTTAAACCCAATATCCCAAAGGGCGGCAGC
3'flank: GCAAGCTCAATGGACTTGCCTACATCACTC
3.Reference Map information
Chrom Position Reference KM5
Chr5 964562 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000009746 271 + C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000015480 271 CGC => TGC ENSCAFP00000042660 91 R => C
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0061003929351 TM2 T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0075003969079 YJ6 Y GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0042004033517 KM7 T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0019003007150 FAMBGSD00001 Y GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0047003776347 LJ2 Y GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0078003953005 YJ9 T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0074003897442 YJ5 T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0004003240679 Basenji T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0052003813638 LJ7 Y GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0048003692510 LJ3 T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0008003931260 DQ10 Y GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0064003907910 TM5 T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0070004105892 YJ1 Y GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0022003464282 FAMICHN00002 Y GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0023003703061 FAMICHN00003 T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0060003786903 TM1 T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0024003045920 GS10 Y GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0065003863801 TM6 T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0046003613881 LJ1 Y GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0021003716502 FAMICHN00001 Y GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0043003269950 KM8 Y GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0011003931364 DQ3 Y GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0013003811102 DQ5 Y GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0057004585030 LUPWRUS00002 Y GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0014003830203 DQ6 T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0068003831864 TM9 T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0036003083579 KM1 Y GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0009003867153 DQ1 Y GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0025003021948 GS1 Y GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0073003884419 YJ4 T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0063003810693 TM4 Y GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0059003877061 TM10 T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0012003872906 DQ4 T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0044003416163 KM9 Y GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0053003790787 LJ8 T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0056004808174 LUPWRUS00001 Y GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0007003282283 Dingo T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0067003822444 TM8 T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0015003869143 DQ7 T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0037003232697 KM2 T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0072003981094 YJ3 Y GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0051003873240 LJ6 Y GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0039003270455 KM4 T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0020003845788 FAMBTIM00001 T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0050003602714 LJ5 Y GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0076003991722 YJ7 T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0016003881107 DQ8 T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0002002576484 CID1 T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-08-02 2014-08-02
snp_cf0041003863270 KM6 T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0066003973292 TM7 Y GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0018003224536 FAMBBEM00001 T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0069003996013 YJ10 T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0038003131028 KM3 T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0071003965304 YJ2 T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
snp_cf0062003878977 TM3 T GTTAAACCCAATATCCCAAAGGGCGGCAGC GCAAGCTCAATGGACTTGCCTACATCACTC 2014-07-19 2014-07-19
6.Fasta Information
CTCTTGTCAA GCCCAAGAAG GTTAAACCCA ATATCCCAAA GGGCGGCAGC
Y
GCAAGCTCAA TGGACTTGCC TACATCACTC ACCCCAAGCT CGGGAAATGT