e.g. 1:1246..9423
SNP Detail For snp_cf0040003372162    [See in GBrowse]
1.General Information
SNP ID: snp_cf0040003372162
Organism: Canis familiaris
Individual: KM5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: GTTCAAGCCGTTCATACGAGAAGCGTCAGT
3'flank: TGCAGTGTCGACAGTATGGCCTTCATGCTG
3.Reference Map information
Chrom Position Reference KM5
Chr5 1025129 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000009799 4370 + G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000015562 319 GTG => ATG ENSCAFP00000014400 107 V => M
+ ENSCAFT00000048354 319 GTG => ATG ENSCAFP00000041968 107 V => M
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0038003131154 KM3 R GTTCAAGCCGTTCATACGAGAAGCGTCAGT TGCAGTGTCGACAGTATGGCCTTCATGCTG 2014-07-19 2014-07-19
snp_cf0064003908026 TM5 R GTTCAAGCCGTTCATACGAGAAGCGTCAGT TGCAGTGTCGACAGTATGGCCTTCATGCTG 2014-07-19 2014-07-19
snp_cf0019003007264 FAMBGSD00001 R GTTCAAGCCGTTCATACGAGAAGCGTCAGT TGCAGTGTCGACAGTATGGCCTTCATGCTG 2014-07-19 2014-07-19
snp_cf0012003873019 DQ4 R GTTCAAGCCGTTCATACGAGAAGCGTCAGT TGCAGTGTCGACAGTATGGCCTTCATGCTG 2014-07-19 2014-07-19
snp_cf0024003046038 GS10 R GTTCAAGCCGTTCATACGAGAAGCGTCAGT TGCAGTGTCGACAGTATGGCCTTCATGCTG 2014-07-19 2014-07-19
snp_cf0041003863396 KM6 R GTTCAAGCCGTTCATACGAGAAGCGTCAGT TGCAGTGTCGACAGTATGGCCTTCATGCTG 2014-07-19 2014-07-19
snp_cf0036003083693 KM1 A GTTCAAGCCGTTCATACGAGAAGCGTCAGT TGCAGTGTCGACAGTATGGCCTTCATGCTG 2014-07-19 2014-07-19
snp_cf0025003022066 GS1 R GTTCAAGCCGTTCATACGAGAAGCGTCAGT TGCAGTGTCGACAGTATGGCCTTCATGCTG 2014-07-19 2014-07-19
snp_cf0042004033644 KM7 R GTTCAAGCCGTTCATACGAGAAGCGTCAGT TGCAGTGTCGACAGTATGGCCTTCATGCTG 2014-07-19 2014-07-19
snp_cf0039003270574 KM4 R GTTCAAGCCGTTCATACGAGAAGCGTCAGT TGCAGTGTCGACAGTATGGCCTTCATGCTG 2014-07-19 2014-07-19
6.Fasta Information
TGGCATTGTT CTATCACTTT GTTCAAGCCG TTCATACGAG AAGCGTCAGT
R
TGCAGTGTCG ACAGTATGGC CTTCATGCTG CTGGGCTTTA TTTTCTGTTG