e.g. 1:1246..9423
SNP Detail For snp_cf0040003372516    [See in GBrowse]
1.General Information
SNP ID: snp_cf0040003372516
Organism: Canis familiaris
Individual: KM5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: CTGTGTGCCTCGCAGGAAGCTGCAGACAGA
3'flank: AGACAGACAGAATGACAGGCTCCTGCGAAC
3.Reference Map information
Chrom Position Reference KM5
Chr5 1309935 G C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000009823 36072 + G CDS
ENSCAFG00000009823 36072 + G intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000015597 3996 GAG => GAC ENSCAFP00000014433 1332 E => D
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0063003811202 TM4 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0019003007592 FAMBGSD00001 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0049003903522 LJ4 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0039003270942 KM4 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0024003046388 GS10 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0046003614241 LJ1 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0035003759215 KM10 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0068003832332 TM9 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0037003233209 KM2 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0009003867664 DQ1 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0067003822907 TM8 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0078003953331 YJ9 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0041003863793 KM6 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0052003814169 LJ7 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0074003897927 YJ5 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0014003830718 DQ6 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0055004779007 LUPWCHN00001 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0007003282742 Dingo C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0004003241099 Basenji C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0064003908386 TM5 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0021003716907 FAMICHN00001 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0027003037060 GS3 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0066003973786 TM7 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0044003416625 KM9 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0026003045463 GS2 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0062003879484 TM3 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0060003787358 TM1 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0038003131525 KM3 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0020003846265 FAMBTIM00001 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0031003071089 GS7 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0036003084029 KM1 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0075003969598 YJ6 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0073003884935 YJ4 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0065003864220 TM6 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0069003996711 YJ10 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0043003270412 KM8 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0032002985048 GS8 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0025003022402 GS1 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0050003603015 LJ5 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0008003931715 DQ10 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0076003992241 YJ7 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0015003869617 DQ7 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0059003877542 TM10 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0005004629678 CHW C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0061003929805 TM2 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0045003540847 LJ10 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0070004106324 YJ1 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0072003981654 YJ3 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0010003892859 DQ2 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0033003051314 GS9 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0047003776771 LJ2 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0028002942339 GS4 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0057004585568 LUPWRUS00002 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0011003931902 DQ3 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0016003881428 DQ8 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0077003946093 YJ8 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0048003692907 LJ3 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0034004477663 ISW C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0030003028702 GS6 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0001001682847 solidGW1 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-08-01 2014-08-01
snp_cf0017003925685 DQ9 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0012003873428 DQ4 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0013003811641 DQ5 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0029002863720 GS5 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0051003873608 LJ6 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0053003791100 LJ8 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0018003224934 FAMBBEM00001 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0042004034054 KM7 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0056004808516 LUPWRUS00001 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0071003965821 YJ2 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
snp_cf0058004773554 LUPWRUS00003 C CTGTGTGCCTCGCAGGAAGCTGCAGACAGA AGACAGACAGAATGACAGGCTCCTGCGAAC 2014-07-19 2014-07-19
6.Fasta Information
GCCACACACC CTACCCCGAC CTGTGTGCCT CGCAGGAAGC TGCAGACAGA
C
AGACAGACAG AATGACAGGC TCCTGCGAAC AGCCCGCCCG AGAGAGCCCA