e.g. 1:1246..9423
SNP Detail For snp_cf0040000920812    [See in GBrowse]
1.General Information
SNP ID: snp_cf0040000920812
Organism: Canis familiaris
Individual: KM5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: CAGGCGAGCGTGGGGGGGGGCCCTGGGCTC
3'flank: CCCCGGCTCGGCCTGCAGCCCTGTGGCCCA
3.Reference Map information
Chrom Position Reference KM5
Chr16 94017 G T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000025598 305 + G intron
ENSCAFG00000031089 352 - G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000048823 352 CGA => AGA ENSCAFP00000041015 118 R => R
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0026000806353 GS2 T CAGGCGAGCGTGGGGGGGGGCCCTGGGCTC CCCCGGCTCGGCCTGCAGCCCTGTGGCCCA 2014-07-19 2014-07-19
snp_cf0036000825151 KM1 T CAGGCGAGCGTGGGGGGGGGCCCTGGGCTC CCCCGGCTCGGCCTGCAGCCCTGTGGCCCA 2014-07-19 2014-07-19
snp_cf0076001075795 YJ7 K CAGGCGAGCGTGGGGGGGGGCCCTGGGCTC CCCCGGCTCGGCCTGCAGCCCTGTGGCCCA 2014-07-19 2014-07-19
snp_cf0008001032850 DQ10 T CAGGCGAGCGTGGGGGGGGGCCCTGGGCTC CCCCGGCTCGGCCTGCAGCCCTGTGGCCCA 2014-07-19 2014-07-19
snp_cf0031000820104 GS7 T CAGGCGAGCGTGGGGGGGGGCCCTGGGCTC CCCCGGCTCGGCCTGCAGCCCTGTGGCCCA 2014-07-19 2014-07-19
snp_cf0064001051457 TM5 T CAGGCGAGCGTGGGGGGGGGCCCTGGGCTC CCCCGGCTCGGCCTGCAGCCCTGTGGCCCA 2014-07-19 2014-07-19
snp_cf0042001073348 KM7 T CAGGCGAGCGTGGGGGGGGGCCCTGGGCTC CCCCGGCTCGGCCTGCAGCCCTGTGGCCCA 2014-07-19 2014-07-19
snp_cf0068001005176 TM9 T CAGGCGAGCGTGGGGGGGGGCCCTGGGCTC CCCCGGCTCGGCCTGCAGCCCTGTGGCCCA 2014-07-19 2014-07-19
snp_cf0013001008456 DQ5 T CAGGCGAGCGTGGGGGGGGGCCCTGGGCTC CCCCGGCTCGGCCTGCAGCCCTGTGGCCCA 2014-07-19 2014-07-19
snp_cf0038000798640 KM3 T CAGGCGAGCGTGGGGGGGGGCCCTGGGCTC CCCCGGCTCGGCCTGCAGCCCTGTGGCCCA 2014-07-19 2014-07-19
snp_cf0024000845682 GS10 T CAGGCGAGCGTGGGGGGGGGCCCTGGGCTC CCCCGGCTCGGCCTGCAGCCCTGTGGCCCA 2014-07-19 2014-07-19
snp_cf0037000884236 KM2 T CAGGCGAGCGTGGGGGGGGGCCCTGGGCTC CCCCGGCTCGGCCTGCAGCCCTGTGGCCCA 2014-07-19 2014-07-19
snp_cf0043000867736 KM8 K CAGGCGAGCGTGGGGGGGGGCCCTGGGCTC CCCCGGCTCGGCCTGCAGCCCTGTGGCCCA 2014-07-19 2014-07-19
snp_cf0078001065184 YJ9 K CAGGCGAGCGTGGGGGGGGGCCCTGGGCTC CCCCGGCTCGGCCTGCAGCCCTGTGGCCCA 2014-07-19 2014-07-19
snp_cf0027000808088 GS3 T CAGGCGAGCGTGGGGGGGGGCCCTGGGCTC CCCCGGCTCGGCCTGCAGCCCTGTGGCCCA 2014-07-19 2014-07-19
snp_cf0077001053360 YJ8 K CAGGCGAGCGTGGGGGGGGGCCCTGGGCTC CCCCGGCTCGGCCTGCAGCCCTGTGGCCCA 2014-07-19 2014-07-19
snp_cf0028000767934 GS4 T CAGGCGAGCGTGGGGGGGGGCCCTGGGCTC CCCCGGCTCGGCCTGCAGCCCTGTGGCCCA 2014-07-19 2014-07-19
snp_cf0065001013929 TM6 T CAGGCGAGCGTGGGGGGGGGCCCTGGGCTC CCCCGGCTCGGCCTGCAGCCCTGTGGCCCA 2014-07-19 2014-07-19
snp_cf0061001055592 TM2 K CAGGCGAGCGTGGGGGGGGGCCCTGGGCTC CCCCGGCTCGGCCTGCAGCCCTGTGGCCCA 2014-07-19 2014-07-19
snp_cf0073001057218 YJ4 K CAGGCGAGCGTGGGGGGGGGCCCTGGGCTC CCCCGGCTCGGCCTGCAGCCCTGTGGCCCA 2014-07-19 2014-07-19
snp_cf0074001060338 YJ5 T CAGGCGAGCGTGGGGGGGGGCCCTGGGCTC CCCCGGCTCGGCCTGCAGCCCTGTGGCCCA 2014-07-19 2014-07-19
snp_cf0041001036797 KM6 K CAGGCGAGCGTGGGGGGGGGCCCTGGGCTC CCCCGGCTCGGCCTGCAGCCCTGTGGCCCA 2014-07-19 2014-07-19
6.Fasta Information
TCGGGGAAGT TGCCTTGGGC CAGGCGAGCG TGGGGGGGGG CCCTGGGCTC
T
CCCCGGCTCG GCCTGCAGCC CTGTGGCCCA GCGTGAGAGG GAGCCCCGCG