e.g. 1:1246..9423
SNP Detail For snp_cf0040000920908    [See in GBrowse]
1.General Information
SNP ID: snp_cf0040000920908
Organism: Canis familiaris
Individual: KM5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: GCCCTCAGACGTGCTTCCAGGGACTGACGT
3'flank: GCCTCGACCGCTGCGTCCCCGGGGGTCCCC
3.Reference Map information
Chrom Position Reference KM5
Chr16 124413 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000014734 688 + C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000042831 219 GTC => GTT ENSCAFP00000040839 73 V => V
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0002000678157 CID1 Y GCCCTCAGACGTGCTTCCAGGGACTGACGT GCCTCGACCGCTGCGTCCCCGGGGGTCCCC 2014-08-02 2014-08-02
snp_cf0044000923188 KM9 Y GCCCTCAGACGTGCTTCCAGGGACTGACGT GCCTCGACCGCTGCGTCCCCGGGGGTCCCC 2014-07-19 2014-07-19
snp_cf0074001060450 YJ5 Y GCCCTCAGACGTGCTTCCAGGGACTGACGT GCCTCGACCGCTGCGTCCCCGGGGGTCCCC 2014-07-19 2014-07-19
snp_cf0069001076069 YJ10 T GCCCTCAGACGTGCTTCCAGGGACTGACGT GCCTCGACCGCTGCGTCCCCGGGGGTCCCC 2014-07-19 2014-07-19
snp_cf0020001032263 FAMBTIM00001 Y GCCCTCAGACGTGCTTCCAGGGACTGACGT GCCTCGACCGCTGCGTCCCCGGGGGTCCCC 2014-07-19 2014-07-19
snp_cf0066001064508 TM7 Y GCCCTCAGACGTGCTTCCAGGGACTGACGT GCCTCGACCGCTGCGTCCCCGGGGGTCCCC 2014-07-19 2014-07-19
snp_cf0052001017697 LJ7 Y GCCCTCAGACGTGCTTCCAGGGACTGACGT GCCTCGACCGCTGCGTCCCCGGGGGTCCCC 2014-07-19 2014-07-19
snp_cf0059001051835 TM10 Y GCCCTCAGACGTGCTTCCAGGGACTGACGT GCCTCGACCGCTGCGTCCCCGGGGGTCCCC 2014-07-19 2014-07-19
snp_cf0068001005270 TM9 Y GCCCTCAGACGTGCTTCCAGGGACTGACGT GCCTCGACCGCTGCGTCCCCGGGGGTCCCC 2014-07-19 2014-07-19
snp_cf0039000836253 KM4 T GCCCTCAGACGTGCTTCCAGGGACTGACGT GCCTCGACCGCTGCGTCCCCGGGGGTCCCC 2014-07-19 2014-07-19
snp_cf0067001009236 TM8 Y GCCCTCAGACGTGCTTCCAGGGACTGACGT GCCTCGACCGCTGCGTCCCCGGGGGTCCCC 2014-07-19 2014-07-19
snp_cf0076001075908 YJ7 Y GCCCTCAGACGTGCTTCCAGGGACTGACGT GCCTCGACCGCTGCGTCCCCGGGGGTCCCC 2014-07-19 2014-07-19
snp_cf0078001065297 YJ9 Y GCCCTCAGACGTGCTTCCAGGGACTGACGT GCCTCGACCGCTGCGTCCCCGGGGGTCCCC 2014-07-19 2014-07-19
snp_cf0021000986594 FAMICHN00001 Y GCCCTCAGACGTGCTTCCAGGGACTGACGT GCCTCGACCGCTGCGTCCCCGGGGGTCCCC 2014-07-19 2014-07-19
snp_cf0056001322917 LUPWRUS00001 Y GCCCTCAGACGTGCTTCCAGGGACTGACGT GCCTCGACCGCTGCGTCCCCGGGGGTCCCC 2014-07-19 2014-07-19
snp_cf0019000807369 FAMBGSD00001 Y GCCCTCAGACGTGCTTCCAGGGACTGACGT GCCTCGACCGCTGCGTCCCCGGGGGTCCCC 2014-07-19 2014-07-19
snp_cf0072001071549 YJ3 Y GCCCTCAGACGTGCTTCCAGGGACTGACGT GCCTCGACCGCTGCGTCCCCGGGGGTCCCC 2014-07-19 2014-07-19
snp_cf0023000992072 FAMICHN00003 Y GCCCTCAGACGTGCTTCCAGGGACTGACGT GCCTCGACCGCTGCGTCCCCGGGGGTCCCC 2014-07-19 2014-07-19
snp_cf0062001045365 TM3 Y GCCCTCAGACGTGCTTCCAGGGACTGACGT GCCTCGACCGCTGCGTCCCCGGGGGTCCCC 2014-07-19 2014-07-19
6.Fasta Information
TGCCCGTCTG CAGATGATGT GCCCTCAGAC GTGCTTCCAG GGACTGACGT
Y
GCCTCGACCG CTGCGTCCCC GGGGGTCCCC GTGAGGCCGG CTGTGTCCGC