e.g. 1:1246..9423
SNP Detail For snp_cf0040000920925    [See in GBrowse]
1.General Information
SNP ID: snp_cf0040000920925
Organism: Canis familiaris
Individual: KM5
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs8646990  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT
3'flank: GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC
3.Reference Map information
Chrom Position Reference KM5
Chr16 132614 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000014734 8889 + C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000042831 1575 TTC => TTT ENSCAFP00000040839 525 F => F
+ ENSCAFT00000023399 1083 TTC => TTT ENSCAFP00000021730 361 F => F
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0003000583692 dbSNP139 T CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0069001076086 YJ10 T CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0016001038553 DQ8 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0031000820228 GS7 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0008001032987 DQ10 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0055001308830 LUPWCHN00001 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0059001051851 TM10 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0018000867900 FAMBBEM00001 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0013001008588 DQ5 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0039000836270 KM4 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0053001016164 LJ8 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0035001011359 KM10 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0051001043527 LJ6 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0076001075925 YJ7 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0017001057835 DQ9 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0070001099298 YJ1 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0060001035772 TM1 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0006001210196 CRW Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0043000867860 KM8 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0068001005286 TM9 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0009001051840 DQ1 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0021000986611 FAMICHN00001 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0061001055689 TM2 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0073001057346 YJ4 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0078001065314 YJ9 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0041001036922 KM6 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0015001045577 DQ7 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0029000749381 GS5 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0020001032280 FAMBTIM00001 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0007000883822 Dingo T CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0010001043200 DQ2 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0048000994942 LJ3 T CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0012001047830 DQ4 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0026000806479 GS2 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0038000798765 KM3 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0011001055642 DQ3 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0075001070633 YJ6 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0062001045383 TM3 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0005001280011 CHW Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0071001064948 YJ2 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0014001026554 DQ6 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0023000992085 FAMICHN00003 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0074001060467 YJ5 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0042001073473 KM7 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0004000866296 Basenji Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0024000845809 GS10 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0077001053487 YJ8 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0033000811284 GS9 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0052001017714 LJ7 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0063001028038 TM4 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0030000829871 GS6 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0047001007405 LJ2 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0044000923204 KM9 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0064001051569 TM5 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0019000807386 FAMBGSD00001 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0057001260843 LUPWRUS00002 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0036000825279 KM1 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0037000884365 KM2 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0065001014059 TM6 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0027000808213 GS3 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0025000803067 GS1 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0058001306910 LUPWRUS00003 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0032000801376 GS8 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0028000768058 GS4 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0056001322935 LUPWRUS00001 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0066001064525 TM7 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0072001071566 YJ3 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0067001009251 TM8 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
snp_cf0049001050450 LJ4 Y CAGTGCTGTCTCCCTGGCAAAGCAGCTGTT GTCGTGCGGGAGCCGTGCCAGCCGCCCCCC 2014-07-19 2014-07-19
6.Fasta Information
GTCCGAGCCT TCAACGACGT CAGTGCTGTC TCCCTGGCAA AGCAGCTGTT
Y
GTCGTGCGGG AGCCGTGCCA GCCGCCCCCC GTGAAGAACA TGGGGCCGGG