e.g. 1:1246..9423
SNP Detail For snp_cf0040000920948    [See in GBrowse]
1.General Information
SNP ID: snp_cf0040000920948
Organism: Canis familiaris
Individual: KM5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: CACCATCATCCTCAGTGGCTCCCAGTCCTA
3'flank: GACCCAGACAACCCCGGGGCCACCCTCAGG
3.Reference Map information
Chrom Position Reference KM5
Chr16 139798 T Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000014734 16073 + T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000042831 1995 TAT => TAC ENSCAFP00000040839 665 Y => Y
+ ENSCAFT00000023399 1503 TAT => TAC ENSCAFP00000021730 501 Y => Y
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0010001043225 DQ2 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0007000883844 Dingo Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0062001045405 TM3 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0012001047855 DQ4 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0025000803093 GS1 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0011001055669 DQ3 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0075001070655 YJ6 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0001000434687 solidGW1 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-08-01 2014-08-01
snp_cf0020001032305 FAMBTIM00001 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0072001071591 YJ3 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0036000825305 KM1 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0014001026579 DQ6 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0013001008613 DQ5 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0005001280033 CHW Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0061001055710 TM2 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0028000768084 GS4 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0073001057372 YJ4 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0042001073499 KM7 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0044000923229 KM9 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0064001051595 TM5 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0006001210215 CRW Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0030000829896 GS6 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0033000811306 GS9 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0027000808239 GS3 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0057001260867 LUPWRUS00002 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0051001043551 LJ6 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0023000992108 FAMICHN00003 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0037000884389 KM2 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0034001232069 ISW Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0058001306933 LUPWRUS00003 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0032000801398 GS8 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0019000807408 FAMBGSD00001 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0056001322957 LUPWRUS00001 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0067001009275 TM8 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0024000845834 GS10 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0055001308854 LUPWCHN00001 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0068001005311 TM9 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0016001038579 DQ8 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0071001064972 YJ2 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0049001050475 LJ4 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0070001099323 YJ1 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0063001028066 TM4 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0065001014086 TM6 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0018000867922 FAMBBEM00001 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0059001051876 TM10 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0052001017740 LJ7 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0039000836295 KM4 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0053001016187 LJ8 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0043000867887 KM8 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0060001035797 TM1 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0017001057858 DQ9 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0015001045600 DQ7 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0066001064550 TM7 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0031000820254 GS7 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0069001076110 YJ10 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0074001060493 YJ5 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0029000749403 GS5 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0041001036948 KM6 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0076001075951 YJ7 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0002000678182 CID1 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-08-02 2014-08-02
snp_cf0026000806504 GS2 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0021000986633 FAMICHN00001 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0009001051864 DQ1 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0004000866321 Basenji Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0038000798789 KM3 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0035001011384 KM10 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0077001053514 YJ8 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0008001033014 DQ10 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0078001065339 YJ9 Y CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
snp_cf0048000994960 LJ3 C CACCATCATCCTCAGTGGCTCCCAGTCCTA GACCCAGACAACCCCGGGGCCACCCTCAGG 2014-07-19 2014-07-19
6.Fasta Information
ATCTCCAGGG CCCCCTCAGT CACCATCATC CTCAGTGGCT CCCAGTCCTA
Y
GACCCAGACA ACCCCGGGGC CACCCTCAGG TGAGCACGGG AAGGCCGTGG