e.g. 1:1246..9423
SNP Detail For snp_cf0040000920961    [See in GBrowse]
1.General Information
SNP ID: snp_cf0040000920961
Organism: Canis familiaris
Individual: KM5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: CGATTCCATGCAGCTGCCGTCCAGCGCACC
3'flank: TCCACGGCGGCGAGCTGCCCGGAGCCCCGT
3.Reference Map information
Chrom Position Reference KM5
Chr16 145435 A R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000014734 21710 + A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000042831 2487 CCA => CCG ENSCAFP00000040839 829 P => P
+ ENSCAFT00000023399 1995 CCA => CCG ENSCAFP00000021730 665 P => P
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0016001038593 DQ8 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0031000820268 GS7 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0070001099339 YJ1 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0069001076126 YJ10 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0059001051892 TM10 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0029000749417 GS5 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0039000836310 KM4 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0065001014100 TM6 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0057001260878 LUPWRUS00002 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0009001051877 DQ1 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0043000867902 KM8 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0055001308869 LUPWCHN00001 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0037000884404 KM2 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0060001035810 TM1 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0076001075967 YJ7 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0035001011397 KM10 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0010001043239 DQ2 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0014001026593 DQ6 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0018000867936 FAMBBEM00001 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0061001055721 TM2 G CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0038000798803 KM3 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0078001065356 YJ9 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0073001057388 YJ4 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0041001036963 KM6 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0008001033030 DQ10 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0015001045611 DQ7 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0006001210226 CRW R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0077001053531 YJ8 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0011001055683 DQ3 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0042001073514 KM7 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0064001051611 TM5 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0034001232085 ISW R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0026000806519 GS2 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0021000986647 FAMICHN00001 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0024000845849 GS10 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0074001060508 YJ5 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0068001005327 TM9 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0058001306945 LUPWRUS00003 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0004000866336 Basenji G CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0023000992120 FAMICHN00003 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0033000811320 GS9 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0030000829911 GS6 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0071001064986 YJ2 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0062001045420 TM3 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0052001017758 LJ7 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0044000923245 KM9 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0012001047868 DQ4 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0075001070668 YJ6 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0036000825317 KM1 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0005001280045 CHW R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0032000801410 GS8 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0027000808253 GS3 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0066001064566 TM7 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0013001008627 DQ5 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0028000768097 GS4 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0072001071607 YJ3 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0017001057869 DQ9 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0019000807422 FAMBGSD00001 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0067001009291 TM8 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0049001050491 LJ4 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0056001322972 LUPWRUS00001 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0025000803104 GS1 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
snp_cf0063001028082 TM4 R CGATTCCATGCAGCTGCCGTCCAGCGCACC TCCACGGCGGCGAGCTGCCCGGAGCCCCGT 2014-07-19 2014-07-19
6.Fasta Information
GGCGCTGCCG GCCTGGGGGC CGATTCCATG CAGCTGCCGT CCAGCGCACC
R
TCCACGGCGG CGAGCTGCCC GGAGCCCCGT GGGACGGGTG TGGCGTCCTC