e.g. 1:1246..9423
SNP Detail For snp_cf0040001265339    [See in GBrowse]
1.General Information
SNP ID: snp_cf0040001265339
Organism: Canis familiaris
Individual: KM5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: CACTCTCCACCAAGAGACAAACTTGTTCAA
3'flank: GCTGCCAGAAAGTAAGCAAATACAATCTCC
3.Reference Map information
Chrom Position Reference KM5
Chr19 137 T G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0016001423285 DQ8 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0008001415516 DQ10 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0025001104344 GS1 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0010001405259 DQ2 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0042001478338 KM7 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0074001442364 YJ5 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0005001735864 CHW G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0060001420825 TM1 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0050001319656 LJ5 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0006001657823 CRW G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0023001328859 FAMICHN00003 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0070001506254 YJ1 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0014001410058 DQ6 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0056001805216 LUPWRUS00001 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0075001459524 YJ6 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0038001106448 KM3 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0069001471579 YJ10 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0043001192687 KM8 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0067001395742 TM8 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0004001188290 Basenji G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0035001374204 KM10 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0027001109452 GS3 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0058001789159 LUPWRUS00003 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0018001198066 FAMBBEM00001 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0028001056984 GS4 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0011001447977 DQ3 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0013001367090 DQ5 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0015001422128 DQ7 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0076001470666 YJ7 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0062001436689 TM3 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0024001147072 GS10 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0017001434914 DQ9 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0071001456175 YJ2 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0045001278744 LJ10 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0052001392452 LJ7 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0039001162153 KM4 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0055001786657 LUPWCHN00001 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0054001267606 LJ9 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0068001379266 TM9 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0009001425314 DQ1 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0073001411387 YJ4 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0021001352449 FAMICHN00001 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0061001447428 TM2 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0057001717666 LUPWRUS00002 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0051001422469 LJ6 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0053001383362 LJ8 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0041001427706 KM6 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0026001097479 GS2 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0033001112086 GS9 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0029001043143 GS5 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0044001257104 KM9 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0007001219113 Dingo G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0048001349399 LJ3 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0036001110788 KM1 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0037001205261 KM2 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0022001284790 FAMICHN00002 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0077001443020 YJ8 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0072001465222 YJ3 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0065001401404 TM6 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0032001089322 GS8 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0047001375310 LJ2 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0046001317636 LJ1 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0064001433564 TM5 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0049001439896 LJ4 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0034001683095 ISW G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0030001108511 GS6 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0019001096294 FAMBGSD00001 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0012001420341 DQ4 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0059001423620 TM10 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0020001412264 FAMBTIM00001 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0078001452726 YJ9 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0063001404623 TM4 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0031001107751 GS7 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
snp_cf0066001454780 TM7 G CACTCTCCACCAAGAGACAAACTTGTTCAA GCTGCCAGAAAGTAAGCAAATACAATCTCC 2014-07-19 2014-07-19
6.Fasta Information
NNNNNNNNNN NNNNAGAGAG CACTCTCCAC CAAGAGACAA ACTTGTTCAA
G
GCTGCCAGAA AGTAAGCAAA TACAATCTCC GGGAAAAACA CCGTATCATA