e.g. 1:1246..9423
SNP Detail For snp_cf0040001265343    [See in GBrowse]
1.General Information
SNP ID: snp_cf0040001265343
Organism: Canis familiaris
Individual: KM5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: A
5'flank: AGAGAGAGAGAGAGAGGCAAAGACACAGGC
3'flank: GAGGGAGAAGCAGGCTCCACGCAGGGAGTC
3.Reference Map information
Chrom Position Reference KM5
Chr19 41729 C A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003613 83729 - C intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0014001410060 DQ6 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0038001106453 KM3 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0005001735944 CHW A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0065001401413 TM6 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0060001420827 TM1 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0046001317705 LJ1 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0072001465296 YJ3 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0023001328934 FAMICHN00003 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0056001805294 LUPWRUS00001 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0034001683114 ISW A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0020001412276 FAMBTIM00001 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0057001717682 LUPWRUS00002 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0004001188299 Basenji A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0007001219134 Dingo A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0008001415525 DQ10 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0021001352453 FAMICHN00001 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0061001447430 TM2 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0062001436691 TM3 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0073001411398 YJ4 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0027001109456 GS3 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0064001433584 TM5 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0028001056988 GS4 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0015001422212 DQ7 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0026001097483 GS2 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0024001147076 GS10 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0042001478350 KM7 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0045001278749 LJ10 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0006001657856 CRW A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0041001427716 KM6 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0017001434919 DQ9 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0068001379289 TM9 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0047001375383 LJ2 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0063001404645 TM4 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0077001443033 YJ8 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0016001423309 DQ8 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0025001104348 GS1 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0039001162158 KM4 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0033001112090 GS9 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0074001442386 YJ5 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0019001096299 FAMBGSD00001 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0018001198072 FAMBBEM00001 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0010001405281 DQ2 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0076001470675 YJ7 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0078001452750 YJ9 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0049001439919 LJ4 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0012001420412 DQ4 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0069001471598 YJ10 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0055001786729 LUPWCHN00001 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0037001205267 KM2 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0059001423631 TM10 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0050001319675 LJ5 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0052001392464 LJ7 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0070001506277 YJ1 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0002000937679 CID1 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-08-02 2014-08-02
snp_cf0075001459545 YJ6 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0067001395766 TM8 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0009001425384 DQ1 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0054001267612 LJ9 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0035001374226 KM10 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0029001043147 GS5 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0032001089326 GS8 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0043001192707 KM8 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0022001284871 FAMICHN00002 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0011001447997 DQ3 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0058001789176 LUPWRUS00003 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0030001108515 GS6 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0036001110793 KM1 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0066001454789 TM7 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0071001456198 YJ2 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0051001422478 LJ6 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0053001383372 LJ8 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0031001107755 GS7 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0013001367110 DQ5 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0044001257113 KM9 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
snp_cf0048001349423 LJ3 A AGAGAGAGAGAGAGAGGCAAAGACACAGGC GAGGGAGAAGCAGGCTCCACGCAGGGAGTC 2014-07-19 2014-07-19
6.Fasta Information
TTAGTCTATG AGAGAGAGAG AGAGAGAGAG AGAGAGGCAA AGACACAGGC
A
GAGGGAGAAG CAGGCTCCAC GCAGGGAGTC TGACAGAACT CGATCCCGGG