e.g. 1:1246..9423
SNP Detail For snp_cf0040001265344    [See in GBrowse]
1.General Information
SNP ID: snp_cf0040001265344
Organism: Canis familiaris
Individual: KM5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: CTGAGCCACCCAGGGATCCTCTGAATATTC
3'flank: TAATATAAAATTTCTGGTCAAAGCTAACCA
3.Reference Map information
Chrom Position Reference KM5
Chr19 41852 A T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003613 83606 - A intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0014001410061 DQ6 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0038001106454 KM3 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0065001401414 TM6 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0072001465298 YJ3 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0006001657857 CRW T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0060001420828 TM1 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0046001317707 LJ1 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0015001422214 DQ7 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0056001805296 LUPWRUS00001 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0023001328936 FAMICHN00003 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0034001683115 ISW T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0020001412277 FAMBTIM00001 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0045001278750 LJ10 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0007001219135 Dingo T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0057001717683 LUPWRUS00002 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0008001415526 DQ10 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0061001447431 TM2 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0016001423310 DQ8 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0064001433585 TM5 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0027001109457 GS3 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0019001096300 FAMBGSD00001 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0059001423632 TM10 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0001000624402 solidGW1 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-08-01 2014-08-01
snp_cf0073001411399 YJ4 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0028001056989 GS4 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0068001379290 TM9 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0021001352454 FAMICHN00001 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0002000937680 CID1 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-08-02 2014-08-02
snp_cf0024001147077 GS10 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0026001097484 GS2 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0041001427717 KM6 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0025001104349 GS1 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0055001786730 LUPWCHN00001 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0039001162159 KM4 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0063001404646 TM4 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0077001443034 YJ8 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0033001112091 GS9 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0047001375385 LJ2 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0074001442387 YJ5 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0049001439920 LJ4 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0042001478351 KM7 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0018001198073 FAMBBEM00001 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0076001470676 YJ7 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0078001452751 YJ9 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0017001434920 DQ9 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0037001205268 KM2 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0050001319676 LJ5 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0070001506278 YJ1 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0052001392465 LJ7 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0012001420414 DQ4 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0062001436692 TM3 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0069001471599 YJ10 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0075001459546 YJ6 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0010001405282 DQ2 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0054001267613 LJ9 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0066001454790 TM7 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0035001374227 KM10 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0009001425386 DQ1 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0029001043148 GS5 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0067001395767 TM8 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0043001192708 KM8 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0058001789177 LUPWRUS00003 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0032001089327 GS8 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0011001447998 DQ3 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0022001284873 FAMICHN00002 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0051001422479 LJ6 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0071001456199 YJ2 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0036001110794 KM1 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0053001383373 LJ8 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0048001349424 LJ3 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0031001107756 GS7 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0030001108516 GS6 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0013001367111 DQ5 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0005001735946 CHW T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0044001257114 KM9 T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
snp_cf0004001188300 Basenji T CTGAGCCACCCAGGGATCCTCTGAATATTC TAATATAAAATTTCTGGTCAAAGCTAACCA 2014-07-19 2014-07-19
6.Fasta Information
CAAAGGCAGG CACTAAACTG CTGAGCCACC CAGGGATCCT CTGAATATTC
T
TAATATAAAA TTTCTGGTCA AAGCTAACCA CCTGGTCTGA AAAAATAAAC