e.g. 1:1246..9423
SNP Detail For snp_cf0040001265346    [See in GBrowse]
1.General Information
SNP ID: snp_cf0040001265346
Organism: Canis familiaris
Individual: KM5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: ACCATGAATTCTTTGGTAGAATTCAAAAGT
3'flank: ATGTATGATCTCCGAAATCTGTAAAATGTT
3.Reference Map information
Chrom Position Reference KM5
Chr19 56656 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003613 68802 - T intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0073001411404 YJ4 C ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0047001375403 LJ2 Y ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0038001106456 KM3 C ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0020001412281 FAMBTIM00001 C ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0065001401417 TM6 Y ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0057001717688 LUPWRUS00002 Y ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0041001427721 KM6 C ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0071001456202 YJ2 Y ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0045001278752 LJ10 C ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0016001423314 DQ8 Y ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0051001422481 LJ6 C ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0066001454793 TM7 Y ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0068001379293 TM9 Y ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0025001104351 GS1 C ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0039001162161 KM4 C ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0059001423635 TM10 C ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0027001109459 GS3 C ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0019001096302 FAMBGSD00001 C ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0021001352457 FAMICHN00001 Y ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0026001097486 GS2 C ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0028001056991 GS4 C ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0077001443038 YJ8 C ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0070001506282 YJ1 Y ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0048001349428 LJ3 Y ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0075001459550 YJ6 Y ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0033001112093 GS9 C ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0049001439923 LJ4 Y ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0024001147079 GS10 C ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0067001395772 TM8 Y ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0042001478354 KM7 C ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0018001198075 FAMBBEM00001 Y ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0017001434925 DQ9 Y ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0056001805314 LUPWRUS00001 Y ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0072001465318 YJ3 Y ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0010001405285 DQ2 Y ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0008001415529 DQ10 Y ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0078001452756 YJ9 Y ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0074001442390 YJ5 Y ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0035001374229 KM10 Y ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0032001089329 GS8 C ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0034001683122 ISW Y ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0036001110796 KM1 C ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0031001107758 GS7 C ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0030001108518 GS6 C ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0004001188303 Basenji C ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0076001470680 YJ7 Y ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0053001383376 LJ8 Y ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0052001392470 LJ7 C ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0037001205270 KM2 C ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0044001257116 KM9 Y ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
snp_cf0029001043150 GS5 C ACCATGAATTCTTTGGTAGAATTCAAAAGT ATGTATGATCTCCGAAATCTGTAAAATGTT 2014-07-19 2014-07-19
6.Fasta Information
GTTAAGGAAA GAAGATCATT ACCATGAATT CTTTGGTAGA ATTCAAAAGT
C
ATGTATGATC TCCGAAATCT GTAAAATGTT AGTGCTGAAG ATATGTGTTT