e.g. 1:1246..9423
SNP Detail For snp_cf0040001265347    [See in GBrowse]
1.General Information
SNP ID: snp_cf0040001265347
Organism: Canis familiaris
Individual: KM5
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs22680540  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: GCTGAAACCGCACCTGGAAGAAAGACTGCC
3'flank: GCTAGGGGTTTCCTCTGATCGCCCCTCTTC
3.Reference Map information
Chrom Position Reference KM5
Chr19 58790 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003613 66668 - A intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0065001401419 TM6 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0038001106457 KM3 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0043001192710 KM8 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0073001411405 YJ4 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0014001410062 DQ6 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0027001109460 GS3 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0058001789183 LUPWRUS00003 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0020001412282 FAMBTIM00001 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0035001374230 KM10 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0047001375405 LJ2 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0060001420829 TM1 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0055001786747 LUPWCHN00001 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0057001717689 LUPWRUS00002 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0011001448001 DQ3 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0012001420431 DQ4 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0041001427722 KM6 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0071001456203 YJ2 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0045001278753 LJ10 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0016001423315 DQ8 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0051001422482 LJ6 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0066001454794 TM7 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0074001442391 YJ5 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0025001104352 GS1 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0068001379294 TM9 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0022001284892 FAMICHN00002 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0039001162162 KM4 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0061001447433 TM2 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0001000624404 solidGW1 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-08-01 2014-08-01
snp_cf0021001352458 FAMICHN00001 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0003000801989 dbSNP139 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0064001433586 TM5 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0019001096303 FAMBGSD00001 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0059001423636 TM10 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0009001425404 DQ1 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0063001404649 TM4 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0002000937684 CID1 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-08-02 2014-08-02
snp_cf0026001097487 GS2 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0028001056992 GS4 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0077001443039 YJ8 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0067001395774 TM8 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0075001459551 YJ6 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0070001506283 YJ1 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0048001349429 LJ3 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0032001089330 GS8 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0013001367114 DQ5 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0033001112094 GS9 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0005001735964 CHW G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0042001478355 KM7 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0018001198076 FAMBBEM00001 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0046001317724 LJ1 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0008001415530 DQ10 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0050001319678 LJ5 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0023001328952 FAMICHN00003 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0017001434926 DQ9 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0072001465319 YJ3 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0024001147080 GS10 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0010001405286 DQ2 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0056001805315 LUPWRUS00001 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0062001436694 TM3 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0078001452757 YJ9 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0054001267614 LJ9 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0015001422231 DQ7 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0036001110797 KM1 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0034001683123 ISW G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0076001470682 YJ7 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0031001107759 GS7 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0006001657872 CRW G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0049001439924 LJ4 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0030001108519 GS6 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0053001383377 LJ8 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0004001188304 Basenji G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0007001219141 Dingo G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0052001392471 LJ7 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0037001205271 KM2 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0029001043151 GS5 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0069001471601 YJ10 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
snp_cf0044001257117 KM9 G GCTGAAACCGCACCTGGAAGAAAGACTGCC GCTAGGGGTTTCCTCTGATCGCCCCTCTTC 2014-07-19 2014-07-19
6.Fasta Information
GAAGGCCTGA GGGACACAGA GCTGAAACCG CACCTGGAAG AAAGACTGCC
G
GCTAGGGGTT TCCTCTGATC GCCCCTCTTC TCTCCATGAT GTGCTTTAAG