e.g. 1:1246..9423
SNP Detail For snp_cf0040001266390    [See in GBrowse]
1.General Information
SNP ID: snp_cf0040001266390
Organism: Canis familiaris
Individual: KM5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: ACTCCAGGAGAAAGCACTTCATCGCGGTTA
3'flank: TTTGCAACTGGGCTAAAAATAGAGTTACAA
3.Reference Map information
Chrom Position Reference KM5
Chr19 1341985 C T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003626 22776 - C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000005832 253 GTA => ATA ENSCAFP00000005401 85 V => I
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0025001105397 GS1 T ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0066001457195 TM7 Y ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0047001377401 LJ2 Y ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0018001200118 FAMBBEM00001 Y ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0058001791424 LUPWRUS00003 Y ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0004001190169 Basenji Y ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0005001737140 CHW T ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0019001097346 FAMBGSD00001 T ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0002000939074 CID1 Y ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-08-02 2014-08-02
snp_cf0034001684196 ISW T ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0001000625199 solidGW1 Y ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-08-01 2014-08-01
snp_cf0007001220950 Dingo Y ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0027001110509 GS3 T ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0075001461517 YJ6 Y ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0052001394003 LJ7 Y ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0006001659585 CRW Y ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0012001422834 DQ4 Y ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0057001719422 LUPWRUS00002 Y ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0076001473086 YJ7 Y ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0077001445165 YJ8 Y ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0009001427840 DQ1 Y ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0032001090375 GS8 T ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0055001788320 LUPWCHN00001 Y ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0020001414330 FAMBTIM00001 Y ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0045001280655 LJ10 Y ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0008001417624 DQ10 Y ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0017001437355 DQ9 Y ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0070001508329 YJ1 Y ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0028001058035 GS4 T ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0024001148123 GS10 T ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0026001098530 GS2 T ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0071001458213 YJ2 Y ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0030001109567 GS6 T ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0031001108805 GS7 T ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0033001113145 GS9 T ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0056001806559 LUPWRUS00001 T ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
snp_cf0029001044182 GS5 T ACTCCAGGAGAAAGCACTTCATCGCGGTTA TTTGCAACTGGGCTAAAAATAGAGTTACAA 2014-07-19 2014-07-19
6.Fasta Information
CTCGAGCGAG ATAACACCTA ACTCCAGGAG AAAGCACTTC ATCGCGGTTA
T
TTTGCAACTG GGCTAAAAAT AGAGTTACAA AGAATCATTT TGGAAAAAAA