e.g. 1:1246..9423
SNP Detail For snp_cf0040001267065    [See in GBrowse]
1.General Information
SNP ID: snp_cf0040001267065
Organism: Canis familiaris
Individual: KM5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: GCGGACCTCGTGGACTCCATCATCAAGGCG
3'flank: GGCCCGGGGACGAGTGGATGCAGGAGCTCG
3.Reference Map information
Chrom Position Reference KM5
Chr19 3059690 T G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003700 211527 + T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000005950 2794 TGG => GGG ENSCAFP00000005512 932 W => G
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0027001111184 GS3 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0031001109475 GS7 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0062001440062 TM3 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0013001369312 DQ5 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0073001415405 YJ4 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0063001408260 TM4 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0015001426264 DQ7 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0068001381640 TM9 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0029001044848 GS5 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0001000626048 solidGW1 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-08-01 2014-08-01
snp_cf0024001148791 GS10 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0048001352651 LJ3 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0030001110243 GS6 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0010001408611 DQ2 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0066001459008 TM7 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0049001443212 LJ4 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0071001459291 YJ2 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0035001377796 KM10 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0042001482162 KM7 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0060001424052 TM1 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0052001395618 LJ7 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0072001467857 YJ3 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0014001413272 DQ6 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0038001109742 KM3 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0061001450793 TM2 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0025001106061 GS1 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0017001438898 DQ9 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0078001457057 YJ9 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0059001425845 TM10 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0075001462488 YJ6 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0044001262069 KM9 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0021001356404 FAMICHN00001 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0069001476569 YJ10 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0020001415967 FAMBTIM00001 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0012001424612 DQ4 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0077001447069 YJ8 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0041001431342 KM6 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0009001429622 DQ1 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0016001427850 DQ8 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0011001450209 DQ3 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0055001789793 LUPWCHN00001 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0033001113808 GS9 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0067001399447 TM8 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0064001437368 TM5 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0008001419343 DQ10 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0074001446418 YJ5 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0028001058700 GS4 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0007001222790 Dingo G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0065001405772 TM6 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0076001474846 YJ7 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0046001321331 LJ1 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0037001207899 KM2 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0026001099203 GS2 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0039001164872 KM4 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0036001114039 KM1 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0043001194765 KM8 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0070001509855 YJ1 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
snp_cf0032001091049 GS8 G GCGGACCTCGTGGACTCCATCATCAAGGCG GGCCCGGGGACGAGTGGATGCAGGAGCTCG 2014-07-19 2014-07-19
6.Fasta Information
TCCCCGGGCT CCCCGACGGC GCGGACCTCG TGGACTCCAT CATCAAGGCG
G
GGCCCGGGGA CGAGTGGATG CAGGAGCTCG ACGAGCTGTT CGGGAACCCC