e.g. 1:1246..9423
SNP Detail For snp_cf0041000482534    [See in GBrowse]
1.General Information
SNP ID: snp_cf0041000482534
Organism: Canis familiaris
Individual: KM6
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: M
5'flank: TGGATTCTTCACAATTTGAAAGGGAGGATC
3'flank: CTAGGGACATCAACAAAGGGCACGTCCCCA
3.Reference Map information
Chrom Position Reference KM6
Chr12 249481 A M
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000386 5767 - A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000000605 180 AGT => AGG ENSCAFP00000000552 60 S => R
- ENSCAFT00000000601 204 AGT => AGG ENSCAFP00000000548 68 S => R
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0073000514173 YJ4 M TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0007000423552 Dingo M TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0054000456652 LJ9 C TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0008000501648 DQ10 M TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0042000496895 KM7 M TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0025000371448 GS1 M TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0006000592409 CRW M TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0018000418681 FAMBBEM00001 C TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0029000337425 GS5 C TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0078000521967 YJ9 C TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0022000471289 FAMICHN00002 C TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0044000444580 KM9 C TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0050000457424 LJ5 M TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0071000519365 YJ2 C TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0012000503883 DQ4 M TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0070000534793 YJ1 C TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0031000389821 GS7 M TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0048000481839 LJ3 M TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0004000420614 Basenji M TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0075000527943 YJ6 M TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0053000492638 LJ8 M TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0035000477798 KM10 C TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0072000524493 YJ3 C TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0009000505504 DQ1 M TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0033000405814 GS9 M TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0038000404430 KM3 M TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0030000395329 GS6 C TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0066000515541 TM7 M TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0024000419161 GS10 M TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0057000630826 LUPWRUS00002 M TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0076000523879 YJ7 C TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0028000383696 GS4 C TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0058000641809 LUPWRUS00003 M TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
snp_cf0043000412635 KM8 M TGGATTCTTCACAATTTGAAAGGGAGGATC CTAGGGACATCAACAAAGGGCACGTCCCCA 2014-07-19 2014-07-19
6.Fasta Information
TTCGCCTTGC CCACAGACCT TGGATTCTTC ACAATTTGAA AGGGAGGATC
M
CTAGGGACAT CAACAAAGGG CACGTCCCCA TAATCTTTCA CATCACAGTC