e.g. 1:1246..9423
SNP Detail For snp_cf0041000482899    [See in GBrowse]
1.General Information
SNP ID: snp_cf0041000482899
Organism: Canis familiaris
Individual: KM6
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs8973464  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: ATCCAGGTGTTGAGCTCTTACCTGAGCCAA
3'flank: CTGATAGACCTCTCGGATATCCAGTTCCAG
3.Reference Map information
Chrom Position Reference KM6
Chr12 382149 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000396 1138 - G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000000627 367 CTT => TTT ENSCAFP00000000572 123 L => F
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0020000500270 FAMBTIM00001 R ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0008000501982 DQ10 R ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0061000515100 TM2 R ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0027000386665 GS3 R ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0033000406117 GS9 R ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0068000494531 TM9 A ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0040000440742 KM5 A ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0063000506899 TM4 R ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0060000521654 TM1 R ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0013000501675 DQ5 R ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0056000652209 LUPWRUS00001 R ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0059000515867 TM10 A ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0046000454590 LJ1 R ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0049000520858 LJ4 R ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0073000514506 YJ4 R ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0038000404738 KM3 R ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0048000482172 LJ3 R ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0074000516276 YJ5 R ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0065000482886 TM6 A ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0026000389797 GS2 A ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0032000383054 GS8 A ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0042000497290 KM7 R ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0055000647133 LUPWCHN00001 R ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0024000419466 GS10 R ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0037000412089 KM2 A ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0039000402302 KM4 A ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0019000386293 FAMBGSD00001 R ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0023000476367 FAMICHN00003 R ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0025000371751 GS1 R ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0036000396733 KM1 A ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0012000504219 DQ4 R ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0051000506105 LJ6 A ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0067000502860 TM8 R ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0001000250918 solidGW1 R ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-08-01 2014-08-01
snp_cf0045000438765 LJ10 R ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0047000477423 LJ2 R ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0003000275954 dbSNP139 A ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
snp_cf0053000492968 LJ8 R ATCCAGGTGTTGAGCTCTTACCTGAGCCAA CTGATAGACCTCTCGGATATCCAGTTCCAG 2014-07-19 2014-07-19
6.Fasta Information
GCACACTGCC TCTCCCAAAT ATCCAGGTGT TGAGCTCTTA CCTGAGCCAA
R
CTGATAGACC TCTCGGATAT CCAGTTCCAG CAGCTCAGCA CTGACAGGCT